Incidental Mutation 'R2431:Isg15'
ID250394
Institutional Source Beutler Lab
Gene Symbol Isg15
Ensembl Gene ENSMUSG00000035692
Gene NameISG15 ubiquitin-like modifier
SynonymsG1p2
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location156199424-156200818 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 156200701 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085425] [ENSMUST00000105140] [ENSMUST00000180572]
Predicted Effect probably null
Transcript: ENSMUST00000085425
SMART Domains Protein: ENSMUSP00000082548
Gene: ENSMUSG00000035692

DomainStartEndE-ValueType
UBQ 3 74 8.2e-24 SMART
UBQ 80 151 2.93e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105140
SMART Domains Protein: ENSMUSP00000100772
Gene: ENSMUSG00000078349

DomainStartEndE-ValueType
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180572
SMART Domains Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NtA 32 159 5.1e-91 PFAM
FOLN 173 198 8.25e-6 SMART
KAZAL 198 244 1.22e-17 SMART
FOLN 249 273 7.58e-5 SMART
EGF_like 249 288 7.38e1 SMART
KAZAL 273 319 1.51e-13 SMART
KAZAL 348 391 1.8e-6 SMART
KAZAL 417 463 1.55e-10 SMART
FOLN 469 491 8.25e-6 SMART
KAZAL 491 536 1.14e-17 SMART
KAZAL 556 601 6.43e-17 SMART
FOLN 603 626 2.94e-2 SMART
KAZAL 614 666 8.96e-16 SMART
low complexity region 672 679 N/A INTRINSIC
KAZAL 706 752 1.12e-16 SMART
EGF_Lam 795 846 3.29e-15 SMART
EGF_Lam 849 893 6.7e-7 SMART
FOLN 902 924 1.94e-2 SMART
KAZAL 924 971 3.9e-16 SMART
low complexity region 996 1013 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
SEA 1121 1243 2.26e-35 SMART
low complexity region 1249 1276 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
EGF 1321 1356 1.49e-4 SMART
LamG 1381 1517 4e-45 SMART
EGF 1541 1575 2.23e-3 SMART
EGF 1580 1614 7.13e-2 SMART
LamG 1649 1785 6.51e-36 SMART
EGF 1806 1842 4.35e-6 SMART
LamG 1878 2014 5.01e-37 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous null mice are viable and fertile and do not display immunological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Isg15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Isg15 APN 4 156199844 missense probably damaging 1.00
IGL03280:Isg15 APN 4 156199862 missense probably benign 0.02
R0787:Isg15 UTSW 4 156199939 missense probably benign 0.19
R1703:Isg15 UTSW 4 156199808 missense possibly damaging 0.89
R1714:Isg15 UTSW 4 156199957 missense probably damaging 1.00
R1757:Isg15 UTSW 4 156199990 missense possibly damaging 0.52
R1984:Isg15 UTSW 4 156199793 missense probably benign 0.00
R2044:Isg15 UTSW 4 156199792 missense probably benign 0.43
R4738:Isg15 UTSW 4 156199862 missense probably benign 0.02
R4911:Isg15 UTSW 4 156199760 missense probably benign 0.00
R4997:Isg15 UTSW 4 156199697 missense possibly damaging 0.58
R5692:Isg15 UTSW 4 156199822 missense probably damaging 1.00
R7504:Isg15 UTSW 4 156200045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAAGGGATCTAGAGCTGGTATC -3'
(R):5'- CCCACTCATTTAAGGTATGCCG -3'

Sequencing Primer
(F):5'- CTGGTATCTGAGCAAAAGAACCTGC -3'
(R):5'- AACAGAAAATAGCTCTGGTTTCTGG -3'
Posted On2014-11-12