Incidental Mutation 'R2431:Rfc5'
ID250396
Institutional Source Beutler Lab
Gene Symbol Rfc5
Ensembl Gene ENSMUSG00000029363
Gene Namereplication factor C (activator 1) 5
Synonyms36.5kDa, 2610209F07Rik, 2610020K06Rik, 36kDa, Recc5
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2431 (G1)
Quality Score187
Status Not validated
Chromosome5
Chromosomal Location117378103-117389047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 117385458 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 92 (S92A)
Ref Sequence ENSEMBL: ENSMUSP00000083652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086461] [ENSMUST00000111953]
Predicted Effect probably damaging
Transcript: ENSMUST00000086461
AA Change: S92A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083652
Gene: ENSMUSG00000029363
AA Change: S92A

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
AAA 51 179 4.16e-14 SMART
Pfam:Rep_fac_C 241 327 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111953
SMART Domains Protein: ENSMUSP00000107584
Gene: ENSMUSG00000029363

DomainStartEndE-ValueType
Pfam:DUF815 3 105 4.8e-8 PFAM
Pfam:RuvB_N 10 100 3e-8 PFAM
Pfam:Rad17 14 110 9.5e-13 PFAM
Pfam:AAA_19 43 94 1.4e-8 PFAM
Pfam:AAA 55 103 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156391
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the smallest subunit of the replication factor C complex, which consists of five distinct subunits (140, 40, 38, 37, and 36 kDa) and is required for DNA replication. This subunit interacts with the C-terminal region of proliferating cell nuclear antigen and is required to open and load proliferating cell nuclear antigen onto DNA during S phase. It is a member of the AAA+ (ATPases associated with various cellular activities) ATPase family and forms a core complex with the 38 and 40 kDa subunits that possesses DNA-dependent ATPase activity. A related pseudogene has been identified on chromosome 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Rfc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Rfc5 APN 5 117386866 splice site probably benign
R2078:Rfc5 UTSW 5 117380803 missense probably benign 0.01
R4787:Rfc5 UTSW 5 117382420 missense probably benign 0.00
R4890:Rfc5 UTSW 5 117386820 missense probably damaging 1.00
R6385:Rfc5 UTSW 5 117385398 missense probably benign 0.03
R6386:Rfc5 UTSW 5 117385398 missense probably benign 0.03
R6963:Rfc5 UTSW 5 117387866 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTCCCTTTATACCAGCCAAGG -3'
(R):5'- TTAACATCAATTGCTCACGGC -3'

Sequencing Primer
(F):5'- CTTTATACCAGCCAAGGGGGAC -3'
(R):5'- GGTCACCAGGCCGTGTTTATTTC -3'
Posted On2014-11-12