Incidental Mutation 'R2431:Olfr447'
ID250398
Institutional Source Beutler Lab
Gene Symbol Olfr447
Ensembl Gene ENSMUSG00000045708
Gene Nameolfactory receptor 447
SynonymsMOR261-1, GA_x6K02T2P3E9-4647978-4647046
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42908878-42914273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42912012 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 163 (L163S)
Ref Sequence ENSEMBL: ENSMUSP00000149325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055763] [ENSMUST00000216408]
Predicted Effect probably damaging
Transcript: ENSMUST00000055763
AA Change: L163S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052312
Gene: ENSMUSG00000045708
AA Change: L163S

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.8e-60 PFAM
Pfam:7tm_1 40 289 6.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216408
AA Change: L163S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Olfr447
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Olfr447 APN 6 42912338 missense probably damaging 1.00
IGL02604:Olfr447 APN 6 42912058 nonsense probably null
IGL02894:Olfr447 APN 6 42911517 splice site probably benign
R0122:Olfr447 UTSW 6 42911955 missense probably benign 0.00
R0172:Olfr447 UTSW 6 42911979 missense probably benign 0.00
R0371:Olfr447 UTSW 6 42911938 missense probably benign 0.14
R1709:Olfr447 UTSW 6 42912144 missense possibly damaging 0.94
R3809:Olfr447 UTSW 6 42912337 missense probably damaging 1.00
R4032:Olfr447 UTSW 6 42911625 missense probably benign 0.08
R4242:Olfr447 UTSW 6 42911546 missense possibly damaging 0.77
R4369:Olfr447 UTSW 6 42912277 nonsense probably null
R4401:Olfr447 UTSW 6 42912326 nonsense probably null
R4565:Olfr447 UTSW 6 42911538 missense probably benign
R5646:Olfr447 UTSW 6 42911523 splice site probably null
R5968:Olfr447 UTSW 6 42911546 missense probably benign
R6804:Olfr447 UTSW 6 42911918 missense probably benign
R6925:Olfr447 UTSW 6 42911857 nonsense probably null
R8170:Olfr447 UTSW 6 42912191 missense possibly damaging 0.73
R8358:Olfr447 UTSW 6 42912042 missense possibly damaging 0.51
R8765:Olfr447 UTSW 6 42912168 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TTGCACACACGGAATGTCTC -3'
(R):5'- AAGTGGAGAAGGCTTTCTGG -3'

Sequencing Primer
(F):5'- ACACGGAATGTCTCCTACTGGTG -3'
(R):5'- CTGTGACTTAATCTTCAGGATGGCAC -3'
Posted On2014-11-12