Incidental Mutation 'R2431:Fbln2'
ID250399
Institutional Source Beutler Lab
Gene Symbol Fbln2
Ensembl Gene ENSMUSG00000064080
Gene Namefibulin 2
Synonyms5730577E14Rik
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location91212455-91272540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91269973 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1065 (E1065G)
Ref Sequence ENSEMBL: ENSMUSP00000048334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041544] [ENSMUST00000113498]
Predicted Effect probably damaging
Transcript: ENSMUST00000041544
AA Change: E1065G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048334
Gene: ENSMUSG00000064080
AA Change: E1065G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF 712 755 1.33e1 SMART
EGF_CA 756 800 1.34e-6 SMART
EGF_CA 801 846 1.65e-6 SMART
EGF_CA 847 894 2.06e-7 SMART
EGF_CA 895 937 3.56e-11 SMART
EGF_CA 938 979 3.48e-14 SMART
EGF_CA 980 1018 1.7e-8 SMART
EGF_CA 1019 1061 8.18e-11 SMART
EGF_CA 1062 1106 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113498
AA Change: E1018G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109126
Gene: ENSMUSG00000064080
AA Change: E1018G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF_CA 709 753 1.34e-6 SMART
EGF_CA 754 799 1.65e-6 SMART
EGF_CA 800 847 2.06e-7 SMART
EGF_CA 848 890 3.56e-11 SMART
EGF_CA 891 932 3.48e-14 SMART
EGF_CA 933 971 1.7e-8 SMART
EGF_CA 972 1014 8.18e-11 SMART
EGF_CA 1015 1059 5.08e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137029
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein, which belongs to the fibulin family. This protein binds various extracellular ligands and calcium. It may play a role during organ development, in particular, during the differentiation of heart, skeletal and neuronal structures. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out alle are viable, fertile and grossly normal with no apparent defects in elastic fiber formation in the aorta and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Fbln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Fbln2 APN 6 91266392 missense probably damaging 1.00
IGL01664:Fbln2 APN 6 91233457 missense probably damaging 0.96
IGL02110:Fbln2 APN 6 91234102 missense probably benign 0.01
IGL02227:Fbln2 APN 6 91256367 missense possibly damaging 0.90
IGL02814:Fbln2 APN 6 91265857 nonsense probably null
IGL03287:Fbln2 APN 6 91233494 missense probably damaging 1.00
IGL03412:Fbln2 APN 6 91271781 missense probably damaging 1.00
IGL03014:Fbln2 UTSW 6 91265919 intron probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R1563:Fbln2 UTSW 6 91263383 nonsense probably null
R1843:Fbln2 UTSW 6 91265775 missense probably damaging 1.00
R1846:Fbln2 UTSW 6 91256417 missense possibly damaging 0.91
R1994:Fbln2 UTSW 6 91234301 missense probably damaging 1.00
R2443:Fbln2 UTSW 6 91259711 missense probably damaging 1.00
R2925:Fbln2 UTSW 6 91265855 missense probably damaging 1.00
R3030:Fbln2 UTSW 6 91233715 missense probably damaging 1.00
R3758:Fbln2 UTSW 6 91256381 missense probably damaging 1.00
R3854:Fbln2 UTSW 6 91266371 missense probably damaging 1.00
R4006:Fbln2 UTSW 6 91269961 splice site probably null
R4627:Fbln2 UTSW 6 91259767 missense probably damaging 1.00
R4752:Fbln2 UTSW 6 91256243 missense probably benign
R4763:Fbln2 UTSW 6 91270000 missense probably damaging 1.00
R4798:Fbln2 UTSW 6 91269186 missense probably benign 0.03
R4877:Fbln2 UTSW 6 91233495 missense probably damaging 1.00
R4878:Fbln2 UTSW 6 91256995 critical splice donor site probably null
R4937:Fbln2 UTSW 6 91264699 missense probably damaging 0.99
R4969:Fbln2 UTSW 6 91271587 missense possibly damaging 0.64
R4996:Fbln2 UTSW 6 91266010 missense probably benign 0.05
R5344:Fbln2 UTSW 6 91266383 missense probably damaging 1.00
R5681:Fbln2 UTSW 6 91271796 missense probably damaging 1.00
R5838:Fbln2 UTSW 6 91271848 missense possibly damaging 0.55
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6288:Fbln2 UTSW 6 91233281 missense probably damaging 1.00
R6433:Fbln2 UTSW 6 91233272 missense probably damaging 1.00
R6451:Fbln2 UTSW 6 91234259 missense probably benign 0.18
R6491:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6520:Fbln2 UTSW 6 91259659 missense probably damaging 1.00
R6657:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6987:Fbln2 UTSW 6 91234229 missense probably benign 0.00
R7344:Fbln2 UTSW 6 91269973 missense probably damaging 0.98
R7485:Fbln2 UTSW 6 91270161 intron probably null
R7488:Fbln2 UTSW 6 91265863 critical splice donor site probably null
R7571:Fbln2 UTSW 6 91268575 missense probably damaging 1.00
R7667:Fbln2 UTSW 6 91233667 missense probably damaging 1.00
R7776:Fbln2 UTSW 6 91269199 missense probably damaging 1.00
R7779:Fbln2 UTSW 6 91233194 missense probably damaging 1.00
Z1088:Fbln2 UTSW 6 91233346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTAGCGGGCAATCATGAAC -3'
(R):5'- GTGTCCCAGTGGCAGTAAAG -3'

Sequencing Primer
(F):5'- CTTTATTCTGAGAAGCCAGCAG -3'
(R):5'- GCAGTAAAGAGCCCTGGATCAC -3'
Posted On2014-11-12