Incidental Mutation 'R2431:Eri1'
ID250407
Institutional Source Beutler Lab
Gene Symbol Eri1
Ensembl Gene ENSMUSG00000031527
Gene Nameexoribonuclease 1
SynonymsEri1, Thex1, 3110010F15Rik
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location35465253-35496196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35476478 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 221 (Y221H)
Ref Sequence ENSEMBL: ENSMUSP00000033927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033927]
Predicted Effect probably damaging
Transcript: ENSMUST00000033927
AA Change: Y221H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033927
Gene: ENSMUSG00000031527
AA Change: Y221H

DomainStartEndE-ValueType
SAP 72 106 1.24e-5 SMART
EXOIII 125 311 4.63e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211536
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, decreased body size beginning at E15.5, and decreased proliferation of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Eri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Eri1 APN 8 35482682 missense possibly damaging 0.53
IGL00990:Eri1 APN 8 35482646 missense probably benign
IGL01732:Eri1 APN 8 35491243 missense possibly damaging 0.85
R1467:Eri1 UTSW 8 35469130 makesense probably null
R1467:Eri1 UTSW 8 35469130 makesense probably null
R1496:Eri1 UTSW 8 35469181 missense possibly damaging 0.92
R3862:Eri1 UTSW 8 35491294 missense possibly damaging 0.85
R4330:Eri1 UTSW 8 35469229 nonsense probably null
R4831:Eri1 UTSW 8 35476519 missense possibly damaging 0.92
R5524:Eri1 UTSW 8 35478609 missense probably benign 0.00
R6594:Eri1 UTSW 8 35482533 missense probably damaging 1.00
R7043:Eri1 UTSW 8 35478638 missense probably damaging 0.99
R7101:Eri1 UTSW 8 35482623 missense probably damaging 0.98
R7626:Eri1 UTSW 8 35474400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGAACAAGTGAATGTCAGG -3'
(R):5'- CTCCAGTTGATGTGTGCCTG -3'

Sequencing Primer
(F):5'- GGGAATATGTACCATCCTGAGAACTC -3'
(R):5'- TGTGCTGCAGGCTACAAG -3'
Posted On2014-11-12