Mutagenetix > Incidental Mutations

Incidental Mutation 'R2431:Olfr834'

250409

Institutional Source

Beutler Lab

Gene Symbol

Olfr834

Ensembl Gene

ENSMUSG00000095525

Gene Name

olfactory receptor 834

Synonyms

MOR153-2, GA_x6K02T2PVTD-12724921-12725859, MOR153-4_p

MMRRC Submission

040392-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.551) question?

Stock #

R2431 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18987990-18988928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18988003 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 5 (N5S)

Ref Sequence

ENSEMBL: ENSMUSP00000083680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086492]

Predicted Effect

probably damaging
Transcript: ENSMUST00000086492
AA Change: N5S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000083680
Gene: ENSMUSG00000095525
AA Change: N5S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	7.2e-51	PFAM
Pfam:7TM_GPCR_Srsx	35	305	7e-6	PFAM
Pfam:7tm_1	41	290	2.9e-20	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap23	T	C	11: 97,452,404	V504A	probably benign	Het
Atr	T	G	9: 95,862,892	N87K	probably benign	Het
Auts2	A	T	5: 132,259,048	L32*	probably null	Het
Bptf	A	G	11: 107,047,240	V2675A	possibly damaging	Het
Brdt	C	T	5: 107,378,015		probably null	Het
Ccdc162	T	C	10: 41,569,845	K444E	probably benign	Het
Cnot1	T	C	8: 95,774,652	D96G	probably damaging	Het
Cpq	C	A	15: 33,594,119	Y425*	probably null	Het
Eri1	A	G	8: 35,476,478	Y221H	probably damaging	Het
Fbln2	A	G	6: 91,269,973	E1065G	probably damaging	Het
Focad	T	C	4: 88,331,027	V837A	unknown	Het
Ica1	G	A	6: 8,658,265	T284I	probably benign	Het
Isg15	C	T	4: 156,200,701		probably null	Het
Ltbp4	T	C	7: 27,319,676	T1073A	possibly damaging	Het
Mmp16	A	T	4: 18,054,491	R332S	probably benign	Het
Myg1	G	C	15: 102,337,736	G349R	probably damaging	Het
Olfr1444	T	C	19: 12,862,606	V277A	probably damaging	Het
Olfr447	T	C	6: 42,912,012	L163S	probably damaging	Het
Olfr703	T	C	7: 106,845,391	V260A	possibly damaging	Het
Piezo2	T	C	18: 63,245,624	H78R	possibly damaging	Het
Pkd1l1	T	C	11: 8,947,197	N121D	probably damaging	Het
Pkhd1	T	C	1: 20,201,165	T3055A	possibly damaging	Het
Ppp5c	C	T	7: 17,015,425	V160M	probably damaging	Het
Ptpn23	G	A	9: 110,386,279	R1438*	probably null	Het
Ptpro	G	A	6: 137,443,585	W183*	probably null	Het
Pygm	T	C	19: 6,393,785	M592T	probably damaging	Het
Qdpr	A	G	5: 45,444,730	V68A	probably damaging	Het
Rfc5	A	C	5: 117,385,458	S92A	probably damaging	Het
Ripor3	T	C	2: 167,989,795	Q362R	probably benign	Het
Ror1	G	A	4: 100,441,155	C575Y	probably damaging	Het
Skint9	T	A	4: 112,389,267	D216V	probably damaging	Het
Sox6	T	C	7: 115,550,007		probably null	Het
Ugp2	A	T	11: 21,329,025	V387D	probably damaging	Het
Umodl1	T	C	17: 30,992,088	S747P	possibly damaging	Het
Vtcn1	A	T	3: 100,825,577	I7F	possibly damaging	Het
Zfp507	C	T	7: 35,795,402	R72H	probably benign	Het

Other mutations in Olfr834

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01804:Olfr834	APN	9	18988840	missense	probably benign	0.16
IGL02073:Olfr834	APN	9	18988325	missense	possibly damaging	0.89
IGL02119:Olfr834	APN	9	18988612	missense	probably benign	0.00
IGL02705:Olfr834	APN	9	18988400	missense	probably benign	0.03
R0462:Olfr834	UTSW	9	18988902	missense	probably benign
R0466:Olfr834	UTSW	9	18988255	missense	probably benign	0.00
R0709:Olfr834	UTSW	9	18988126	missense	probably damaging	0.98
R0711:Olfr834	UTSW	9	18988151	missense	probably benign	0.04
R1268:Olfr834	UTSW	9	18988356	missense	probably damaging	0.98
R1663:Olfr834	UTSW	9	18988710	missense	probably damaging	0.99
R1680:Olfr834	UTSW	9	18988516	missense	possibly damaging	0.81
R1686:Olfr834	UTSW	9	18988543	missense	probably damaging	1.00
R1903:Olfr834	UTSW	9	18988896	nonsense	probably null
R1907:Olfr834	UTSW	9	18988441	missense	possibly damaging	0.82
R1911:Olfr834	UTSW	9	18988900	missense	probably damaging	0.99
R2143:Olfr834	UTSW	9	18988803	missense	probably benign	0.06
R4014:Olfr834	UTSW	9	18988882	missense	probably benign	0.08
R4515:Olfr834	UTSW	9	18987982	splice site	probably null
R4575:Olfr834	UTSW	9	18988705	nonsense	probably null
R6974:Olfr834	UTSW	9	18988393	missense	probably damaging	0.99
R7394:Olfr834	UTSW	9	18988710	missense	probably damaging	0.99
R7455:Olfr834	UTSW	9	18988854	missense	possibly damaging	0.92
R7828:Olfr834	UTSW	9	18988920	missense	probably benign
R7962:Olfr834	UTSW	9	18988656	missense	probably damaging	0.97
R8360:Olfr834	UTSW	9	18988843	missense	probably benign	0.28
R8812:Olfr834	UTSW	9	18988516	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- ATGTGTTGGTTAACCTAGTTCCTC -3'
(R):5'- TCACCAGCATTTTGGGGATGG -3'

Sequencing Primer
(F):5'- AAGTAGAATTACTCTGTTCCAACATG -3'
(R):5'- TGGTGGTAGTGAAACATATGTCAATG -3'

Posted On

2014-11-12