Incidental Mutation 'R2431:Olfr834'
ID250409
Institutional Source Beutler Lab
Gene Symbol Olfr834
Ensembl Gene ENSMUSG00000095525
Gene Nameolfactory receptor 834
SynonymsMOR153-2, GA_x6K02T2PVTD-12724921-12725859, MOR153-4_p
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.706) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18987990-18988928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18988003 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 5 (N5S)
Ref Sequence ENSEMBL: ENSMUSP00000083680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086492]
Predicted Effect probably damaging
Transcript: ENSMUST00000086492
AA Change: N5S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083680
Gene: ENSMUSG00000095525
AA Change: N5S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7e-6 PFAM
Pfam:7tm_1 41 290 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Olfr834
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr834 APN 9 18988840 missense probably benign 0.16
IGL02073:Olfr834 APN 9 18988325 missense possibly damaging 0.89
IGL02119:Olfr834 APN 9 18988612 missense probably benign 0.00
IGL02705:Olfr834 APN 9 18988400 missense probably benign 0.03
R0462:Olfr834 UTSW 9 18988902 missense probably benign
R0466:Olfr834 UTSW 9 18988255 missense probably benign 0.00
R0709:Olfr834 UTSW 9 18988126 missense probably damaging 0.98
R0711:Olfr834 UTSW 9 18988151 missense probably benign 0.04
R1268:Olfr834 UTSW 9 18988356 missense probably damaging 0.98
R1663:Olfr834 UTSW 9 18988710 missense probably damaging 0.99
R1680:Olfr834 UTSW 9 18988516 missense possibly damaging 0.81
R1686:Olfr834 UTSW 9 18988543 missense probably damaging 1.00
R1903:Olfr834 UTSW 9 18988896 nonsense probably null
R1907:Olfr834 UTSW 9 18988441 missense possibly damaging 0.82
R1911:Olfr834 UTSW 9 18988900 missense probably damaging 0.99
R2143:Olfr834 UTSW 9 18988803 missense probably benign 0.06
R4014:Olfr834 UTSW 9 18988882 missense probably benign 0.08
R4515:Olfr834 UTSW 9 18987982 unclassified probably null
R4575:Olfr834 UTSW 9 18988705 nonsense probably null
R6974:Olfr834 UTSW 9 18988393 missense probably damaging 0.99
R7394:Olfr834 UTSW 9 18988710 missense probably damaging 0.99
R7455:Olfr834 UTSW 9 18988854 missense possibly damaging 0.92
R7828:Olfr834 UTSW 9 18988920 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGTTGGTTAACCTAGTTCCTC -3'
(R):5'- TCACCAGCATTTTGGGGATGG -3'

Sequencing Primer
(F):5'- AAGTAGAATTACTCTGTTCCAACATG -3'
(R):5'- TGGTGGTAGTGAAACATATGTCAATG -3'
Posted On2014-11-12