Incidental Mutation 'R2431:Ptpn23'
ID250411
Institutional Source Beutler Lab
Gene Symbol Ptpn23
Ensembl Gene ENSMUSG00000036057
Gene Nameprotein tyrosine phosphatase, non-receptor type 23
SynonymsPTP-TD14
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110385082-110408213 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 110386279 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1438 (R1438*)
Ref Sequence ENSEMBL: ENSMUSP00000039580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040021] [ENSMUST00000098350]
PDB Structure
MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000040021
AA Change: R1438*
SMART Domains Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057
AA Change: R1438*

DomainStartEndE-ValueType
BRO1 8 384 5.94e-159 SMART
Pfam:ALIX_LYPXL_bnd 416 704 1.4e-64 PFAM
low complexity region 715 728 N/A INTRINSIC
low complexity region 774 785 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 905 928 N/A INTRINSIC
internal_repeat_1 929 942 8.2e-5 PROSPERO
internal_repeat_1 943 956 8.2e-5 PROSPERO
low complexity region 977 1018 N/A INTRINSIC
low complexity region 1040 1061 N/A INTRINSIC
low complexity region 1088 1106 N/A INTRINSIC
low complexity region 1128 1160 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
low complexity region 1225 1235 N/A INTRINSIC
PTPc 1246 1510 1.28e-92 SMART
low complexity region 1576 1587 N/A INTRINSIC
low complexity region 1589 1643 N/A INTRINSIC
Blast:PTPc 1644 1673 9e-8 BLAST
low complexity region 1675 1689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098350
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200278
Predicted Effect probably benign
Transcript: ENSMUST00000200531
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Embryos homozygous for a gene trap allele are significantly growth retarded and fail to reach the E8.5 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Ptpn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Ptpn23 APN 9 110388106 missense probably benign 0.00
IGL01462:Ptpn23 APN 9 110408107 missense probably benign 0.33
IGL01666:Ptpn23 APN 9 110386545 missense possibly damaging 0.95
IGL01757:Ptpn23 APN 9 110391636 missense probably damaging 1.00
IGL02402:Ptpn23 APN 9 110393713 missense possibly damaging 0.81
IGL02891:Ptpn23 APN 9 110388020 nonsense probably null
peony UTSW 9 110386507 missense probably damaging 0.97
FR4449:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4548:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4737:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4976:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
R0111:Ptpn23 UTSW 9 110385623 missense probably damaging 0.97
R0377:Ptpn23 UTSW 9 110388132 missense possibly damaging 0.73
R0432:Ptpn23 UTSW 9 110389010 critical splice donor site probably null
R0456:Ptpn23 UTSW 9 110389793 splice site probably null
R0457:Ptpn23 UTSW 9 110386293 missense possibly damaging 0.95
R0988:Ptpn23 UTSW 9 110388777 missense probably benign 0.02
R1072:Ptpn23 UTSW 9 110386595 missense probably benign 0.29
R1769:Ptpn23 UTSW 9 110391678 missense possibly damaging 0.89
R1859:Ptpn23 UTSW 9 110388870 missense possibly damaging 0.92
R1891:Ptpn23 UTSW 9 110393800 missense possibly damaging 0.74
R1915:Ptpn23 UTSW 9 110386507 missense probably damaging 0.97
R1954:Ptpn23 UTSW 9 110386325 missense probably damaging 0.99
R2299:Ptpn23 UTSW 9 110392513 missense possibly damaging 0.72
R2445:Ptpn23 UTSW 9 110387632 missense possibly damaging 0.79
R3014:Ptpn23 UTSW 9 110389695 missense probably benign
R3820:Ptpn23 UTSW 9 110389794 unclassified probably benign
R3904:Ptpn23 UTSW 9 110389245 missense probably benign 0.11
R4441:Ptpn23 UTSW 9 110392725 missense probably benign 0.01
R4464:Ptpn23 UTSW 9 110386813 missense probably damaging 1.00
R4709:Ptpn23 UTSW 9 110388856 missense possibly damaging 0.86
R4810:Ptpn23 UTSW 9 110389136 missense possibly damaging 0.93
R4937:Ptpn23 UTSW 9 110392738 missense probably benign 0.09
R5023:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5057:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5065:Ptpn23 UTSW 9 110398188 missense possibly damaging 0.91
R5143:Ptpn23 UTSW 9 110385438 unclassified probably benign
R5370:Ptpn23 UTSW 9 110385701 missense possibly damaging 0.79
R5534:Ptpn23 UTSW 9 110392741 missense possibly damaging 0.95
R5715:Ptpn23 UTSW 9 110387075 missense probably damaging 1.00
R5914:Ptpn23 UTSW 9 110385443 unclassified probably benign
R6122:Ptpn23 UTSW 9 110387825 unclassified probably benign
R6155:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6156:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6296:Ptpn23 UTSW 9 110393826 missense probably damaging 0.96
R6755:Ptpn23 UTSW 9 110389787 missense probably damaging 0.98
R7018:Ptpn23 UTSW 9 110385816 missense possibly damaging 0.89
R7126:Ptpn23 UTSW 9 110388744 missense probably benign 0.00
R7181:Ptpn23 UTSW 9 110385257 missense unknown
R7578:Ptpn23 UTSW 9 110387608 missense probably benign 0.33
R7675:Ptpn23 UTSW 9 110387026 nonsense probably null
R7776:Ptpn23 UTSW 9 110386300 missense possibly damaging 0.89
R7797:Ptpn23 UTSW 9 110393807 missense possibly damaging 0.86
X0062:Ptpn23 UTSW 9 110387707 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATGTGTTTCCTCTGCTG -3'
(R):5'- CTACTTGGCCTGAGTTGTGC -3'

Sequencing Primer
(F):5'- GGCAGCTCTGGAATCCCATTC -3'
(R):5'- GCCTGAGTTGTGCGTTTAC -3'
Posted On2014-11-12