Incidental Mutation 'R2431:Ugp2'
ID250413
Institutional Source Beutler Lab
Gene Symbol Ugp2
Ensembl Gene ENSMUSG00000001891
Gene NameUDP-glucose pyrophosphorylase 2
Synonyms
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location21321138-21371201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21329025 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 387 (V387D)
Ref Sequence ENSEMBL: ENSMUSP00000099939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060895] [ENSMUST00000102875]
Predicted Effect probably damaging
Transcript: ENSMUST00000060895
AA Change: V376D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056324
Gene: ENSMUSG00000001891
AA Change: V376D

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
Pfam:UDPGP 43 462 2.1e-197 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102875
AA Change: V387D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099939
Gene: ENSMUSG00000001891
AA Change: V387D

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:UDPGP 55 473 3.5e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133343
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is an important intermediary in mammalian carbohydrate interconversions. It transfers a glucose moiety from glucose-1-phosphate to MgUTP and forms UDP-glucose and MgPPi. In liver and muscle tissue, UDP-glucose is a direct precursor of glycogen; in lactating mammary gland it is converted to UDP-galactose which is then converted to lactose. The eukaryotic enzyme has no significant sequence similarity to the prokaryotic enzyme. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Ugp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ugp2 APN 11 21354345 missense probably benign
IGL01161:Ugp2 APN 11 21323273 missense possibly damaging 0.82
IGL01759:Ugp2 APN 11 21353447 missense probably benign 0.01
IGL03037:Ugp2 APN 11 21332540 nonsense probably null
IGL03092:Ugp2 APN 11 21329722 splice site probably benign
bittern UTSW 11 21322051 unclassified probably null
PIT4377001:Ugp2 UTSW 11 21370203 start codon destroyed probably null 0.33
R1538:Ugp2 UTSW 11 21333791 missense possibly damaging 0.88
R1658:Ugp2 UTSW 11 21333774 missense probably benign
R1771:Ugp2 UTSW 11 21329915 missense probably damaging 1.00
R1874:Ugp2 UTSW 11 21329048 missense probably damaging 1.00
R1970:Ugp2 UTSW 11 21328942 missense probably damaging 0.99
R2143:Ugp2 UTSW 11 21328949 missense probably benign
R3888:Ugp2 UTSW 11 21353366 missense probably benign 0.01
R4352:Ugp2 UTSW 11 21329026 missense probably damaging 0.99
R5018:Ugp2 UTSW 11 21331052 missense probably damaging 1.00
R6125:Ugp2 UTSW 11 21329815 missense probably damaging 0.97
R6388:Ugp2 UTSW 11 21322051 unclassified probably null
R6466:Ugp2 UTSW 11 21328883 missense probably benign 0.01
R6626:Ugp2 UTSW 11 21331028 missense probably damaging 1.00
R7219:Ugp2 UTSW 11 21323271 missense probably damaging 1.00
R7822:Ugp2 UTSW 11 21333762 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCATACAAAGTCAGTAGTGG -3'
(R):5'- TCTGAGACCACTTCCCAAGTAC -3'

Sequencing Primer
(F):5'- CAGTAGTGGAACATAATTCTCCAAG -3'
(R):5'- ACATACAGCCTGTGTTTACTGG -3'
Posted On2014-11-12