Incidental Mutation 'R2431:Cpq'
ID250418
Institutional Source Beutler Lab
Gene Symbol Cpq
Ensembl Gene ENSMUSG00000039007
Gene Namecarboxypeptidase Q
Synonyms2610034C17Rik, HLS2, Lal-1, Pgcp, 1190003P12Rik
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location33083129-33594552 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 33594119 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 425 (Y425*)
Ref Sequence ENSEMBL: ENSMUSP00000154400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042167] [ENSMUST00000228916]
Predicted Effect probably null
Transcript: ENSMUST00000042167
AA Change: Y425*
SMART Domains Protein: ENSMUSP00000039046
Gene: ENSMUSG00000039007
AA Change: Y425*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
Pfam:Peptidase_M28 268 457 5.9e-29 PFAM
Pfam:Peptidase_M20 284 457 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228272
Predicted Effect probably null
Transcript: ENSMUST00000228916
AA Change: Y425*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallopeptidase that belongs to the peptidase M28 family. The encoded protein may catalyze the cleavage of dipeptides with unsubstituted terminals into amino acids. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Cpq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Cpq APN 15 33497287 missense probably benign
IGL01773:Cpq APN 15 33212850 missense probably benign 0.42
IGL02406:Cpq APN 15 33302508 missense probably damaging 1.00
IGL02527:Cpq APN 15 33302363 missense probably damaging 1.00
IGL02596:Cpq APN 15 33213014 missense probably damaging 1.00
IGL02642:Cpq APN 15 33381400 missense probably damaging 0.99
IGL03382:Cpq APN 15 33212943 missense probably damaging 0.96
R0309:Cpq UTSW 15 33594151 missense probably damaging 1.00
R1545:Cpq UTSW 15 33250000 missense probably damaging 1.00
R1698:Cpq UTSW 15 33250126 missense probably benign 0.45
R1967:Cpq UTSW 15 33497202 missense possibly damaging 0.65
R2321:Cpq UTSW 15 33594145 missense probably benign
R4705:Cpq UTSW 15 33497338 missense probably benign
R5087:Cpq UTSW 15 33212862 missense probably benign 0.08
R5367:Cpq UTSW 15 33213104 missense possibly damaging 0.91
R5790:Cpq UTSW 15 33249997 missense probably damaging 1.00
R6347:Cpq UTSW 15 33290186 intron probably null
R7319:Cpq UTSW 15 33250039 missense probably benign 0.02
R7495:Cpq UTSW 15 33302440 missense probably damaging 0.98
R7711:Cpq UTSW 15 33497347 missense probably benign 0.04
R7806:Cpq UTSW 15 33497297 missense possibly damaging 0.83
X0063:Cpq UTSW 15 33213252 missense probably damaging 1.00
Z1176:Cpq UTSW 15 33381391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTACTGCAGAATAAGGTTTTGG -3'
(R):5'- ACAGAGAACAAGGTCCTCTCTTC -3'

Sequencing Primer
(F):5'- CTCTCCCTCAGTGATGAAGAGATAG -3'
(R):5'- CTTGTTCTCCTTAGGACCTGGG -3'
Posted On2014-11-12