Incidental Mutation 'R2431:Myg1'
ID250419
Institutional Source Beutler Lab
Gene Symbol Myg1
Ensembl Gene ENSMUSG00000001285
Gene Namemelanocyte proliferating gene 1
SynonymsGamm1
MMRRC Submission 040392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2431 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102331709-102338139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 102337736 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 349 (G349R)
Ref Sequence ENSEMBL: ENSMUSP00000109312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001331] [ENSMUST00000041208] [ENSMUST00000113682] [ENSMUST00000228959] [ENSMUST00000229900] [ENSMUST00000230481] [ENSMUST00000231061]
Predicted Effect probably damaging
Transcript: ENSMUST00000001331
AA Change: G295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001331
Gene: ENSMUSG00000001285
AA Change: G295R

DomainStartEndE-ValueType
Pfam:UPF0160 41 161 4.8e-54 PFAM
Pfam:UPF0160 158 312 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041208
SMART Domains Protein: ENSMUSP00000044604
Gene: ENSMUSG00000036678

DomainStartEndE-ValueType
WD40 136 179 3.7e0 SMART
WD40 181 221 4.75e1 SMART
WD40 232 273 1.17e-5 SMART
WD40 278 315 2.66e0 SMART
Blast:WD40 319 357 2e-15 BLAST
low complexity region 534 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113682
AA Change: G349R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109312
Gene: ENSMUSG00000001285
AA Change: G349R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPF0160 45 365 1.5e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170713
Predicted Effect unknown
Transcript: ENSMUST00000171244
AA Change: G303R
SMART Domains Protein: ENSMUSP00000129494
Gene: ENSMUSG00000001285
AA Change: G303R

DomainStartEndE-ValueType
Pfam:UPF0160 41 209 1.7e-76 PFAM
Pfam:UPF0160 204 306 3.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171733
Predicted Effect probably benign
Transcript: ENSMUST00000228959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229589
Predicted Effect probably benign
Transcript: ENSMUST00000229900
Predicted Effect probably benign
Transcript: ENSMUST00000230239
Predicted Effect probably benign
Transcript: ENSMUST00000230406
Predicted Effect probably benign
Transcript: ENSMUST00000230481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230812
Predicted Effect probably benign
Transcript: ENSMUST00000231061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231099
Meta Mutation Damage Score 0.9645 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display no gross abnormalities but altered sex-dependent anxiety-like behaviors in different tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 T C 11: 97,452,404 V504A probably benign Het
Atr T G 9: 95,862,892 N87K probably benign Het
Auts2 A T 5: 132,259,048 L32* probably null Het
Bptf A G 11: 107,047,240 V2675A possibly damaging Het
Brdt C T 5: 107,378,015 probably null Het
Ccdc162 T C 10: 41,569,845 K444E probably benign Het
Cnot1 T C 8: 95,774,652 D96G probably damaging Het
Cpq C A 15: 33,594,119 Y425* probably null Het
Eri1 A G 8: 35,476,478 Y221H probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Focad T C 4: 88,331,027 V837A unknown Het
Ica1 G A 6: 8,658,265 T284I probably benign Het
Isg15 C T 4: 156,200,701 probably null Het
Ltbp4 T C 7: 27,319,676 T1073A possibly damaging Het
Mmp16 A T 4: 18,054,491 R332S probably benign Het
Olfr1444 T C 19: 12,862,606 V277A probably damaging Het
Olfr447 T C 6: 42,912,012 L163S probably damaging Het
Olfr703 T C 7: 106,845,391 V260A possibly damaging Het
Olfr834 A G 9: 18,988,003 N5S probably damaging Het
Piezo2 T C 18: 63,245,624 H78R possibly damaging Het
Pkd1l1 T C 11: 8,947,197 N121D probably damaging Het
Pkhd1 T C 1: 20,201,165 T3055A possibly damaging Het
Ppp5c C T 7: 17,015,425 V160M probably damaging Het
Ptpn23 G A 9: 110,386,279 R1438* probably null Het
Ptpro G A 6: 137,443,585 W183* probably null Het
Pygm T C 19: 6,393,785 M592T probably damaging Het
Qdpr A G 5: 45,444,730 V68A probably damaging Het
Rfc5 A C 5: 117,385,458 S92A probably damaging Het
Ripor3 T C 2: 167,989,795 Q362R probably benign Het
Ror1 G A 4: 100,441,155 C575Y probably damaging Het
Skint9 T A 4: 112,389,267 D216V probably damaging Het
Sox6 T C 7: 115,550,007 probably null Het
Ugp2 A T 11: 21,329,025 V387D probably damaging Het
Umodl1 T C 17: 30,992,088 S747P possibly damaging Het
Vtcn1 A T 3: 100,825,577 I7F possibly damaging Het
Zfp507 C T 7: 35,795,402 R72H probably benign Het
Other mutations in Myg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Myg1 APN 15 102334338 missense probably benign 0.00
IGL02188:Myg1 APN 15 102337441 missense probably benign 0.08
IGL02373:Myg1 APN 15 102336833 missense probably damaging 0.99
IGL02885:Myg1 APN 15 102332159 missense probably damaging 1.00
IGL03066:Myg1 APN 15 102334366 unclassified probably benign
R0583:Myg1 UTSW 15 102337790 nonsense probably null
R0631:Myg1 UTSW 15 102331849 missense probably benign 0.00
R0835:Myg1 UTSW 15 102332102 missense probably damaging 1.00
R1016:Myg1 UTSW 15 102334351 missense possibly damaging 0.50
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1757:Myg1 UTSW 15 102331829 missense probably benign
R2400:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2428:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2429:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2997:Myg1 UTSW 15 102337510 missense probably null 1.00
R3683:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3826:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3827:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3829:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R4923:Myg1 UTSW 15 102331853 missense probably benign
R5363:Myg1 UTSW 15 102337824 missense probably benign 0.00
R5419:Myg1 UTSW 15 102336962 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTCTACCTACCTTGAAGTCTGTC -3'
(R):5'- AGATGGTTGTCAACTGAAAAGC -3'

Sequencing Primer
(F):5'- ACCTTGAAGTCTGTCTCAGCAC -3'
(R):5'- GTTGTCAACTGAAAAGCAAAGCAC -3'
Posted On2014-11-12