Mutagenetix > Incidental Mutation

Incidental Mutation 'R2431:Umodl1'

250420

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

040392-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2431 (G1)

Quality Score

106

Status

Not validated

Chromosome

Chromosomal Location

31173614-31229684 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31211062 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 747 (S747P)

Ref Sequence

ENSEMBL: ENSMUSP00000065470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066554
AA Change: S862P

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: S862P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066981
AA Change: S747P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: S747P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114555
AA Change: S862P

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: S862P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap23	T	C	11: 97,343,230 (GRCm39)	V504A	probably benign	Het
Atr	T	G	9: 95,744,945 (GRCm39)	N87K	probably benign	Het
Auts2	A	T	5: 132,287,887 (GRCm39)	L32*	probably null	Het
Bptf	A	G	11: 106,938,066 (GRCm39)	V2675A	possibly damaging	Het
Brdt	C	T	5: 107,525,881 (GRCm39)		probably null	Het
Ccdc162	T	C	10: 41,445,841 (GRCm39)	K444E	probably benign	Het
Cnot1	T	C	8: 96,501,280 (GRCm39)	D96G	probably damaging	Het
Cpq	C	A	15: 33,594,265 (GRCm39)	Y425*	probably null	Het
Eri1	A	G	8: 35,943,632 (GRCm39)	Y221H	probably damaging	Het
Fbln2	A	G	6: 91,246,955 (GRCm39)	E1065G	probably damaging	Het
Focad	T	C	4: 88,249,264 (GRCm39)	V837A	unknown	Het
Ica1	G	A	6: 8,658,265 (GRCm39)	T284I	probably benign	Het
Isg15	C	T	4: 156,285,158 (GRCm39)		probably null	Het
Ltbp4	T	C	7: 27,019,101 (GRCm39)	T1073A	possibly damaging	Het
Mmp16	A	T	4: 18,054,491 (GRCm39)	R332S	probably benign	Het
Myg1	G	C	15: 102,246,171 (GRCm39)	G349R	probably damaging	Het
Or2a25	T	C	6: 42,888,946 (GRCm39)	L163S	probably damaging	Het
Or2ag19	T	C	7: 106,444,598 (GRCm39)	V260A	possibly damaging	Het
Or5b21	T	C	19: 12,839,970 (GRCm39)	V277A	probably damaging	Het
Or7g12	A	G	9: 18,899,299 (GRCm39)	N5S	probably damaging	Het
Piezo2	T	C	18: 63,378,695 (GRCm39)	H78R	possibly damaging	Het
Pkd1l1	T	C	11: 8,897,197 (GRCm39)	N121D	probably damaging	Het
Pkhd1	T	C	1: 20,271,389 (GRCm39)	T3055A	possibly damaging	Het
Ppp5c	C	T	7: 16,749,350 (GRCm39)	V160M	probably damaging	Het
Ptpn23	G	A	9: 110,215,347 (GRCm39)	R1438*	probably null	Het
Ptpro	G	A	6: 137,420,583 (GRCm39)	W183*	probably null	Het
Pygm	T	C	19: 6,443,815 (GRCm39)	M592T	probably damaging	Het
Qdpr	A	G	5: 45,602,072 (GRCm39)	V68A	probably damaging	Het
Rfc5	A	C	5: 117,523,523 (GRCm39)	S92A	probably damaging	Het
Ripor3	T	C	2: 167,831,715 (GRCm39)	Q362R	probably benign	Het
Ror1	G	A	4: 100,298,352 (GRCm39)	C575Y	probably damaging	Het
Skint9	T	A	4: 112,246,464 (GRCm39)	D216V	probably damaging	Het
Sox6	T	C	7: 115,149,242 (GRCm39)		probably null	Het
Ugp2	A	T	11: 21,279,025 (GRCm39)	V387D	probably damaging	Het
Vtcn1	A	T	3: 100,732,893 (GRCm39)	I7F	possibly damaging	Het
Zfp507	C	T	7: 35,494,827 (GRCm39)	R72H	probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31,227,724 (GRCm39)	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	31,215,238 (GRCm39)	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	31,215,233 (GRCm39)	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	31,217,800 (GRCm39)	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	31,215,229 (GRCm39)	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	31,201,294 (GRCm39)	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	31,192,742 (GRCm39)	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	31,206,888 (GRCm39)	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	31,205,091 (GRCm39)	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	31,213,789 (GRCm39)	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	31,187,415 (GRCm39)	splice site	probably benign
IGL02496:Umodl1	APN	17	31,217,628 (GRCm39)	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	31,208,462 (GRCm39)	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	31,205,473 (GRCm39)	nonsense	probably null
IGL03392:Umodl1	APN	17	31,215,329 (GRCm39)	missense	probably damaging	0.98
Disquieting	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
floored	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7231_umodl1_507	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
surprising	UTSW	17	31,205,439 (GRCm39)	missense	possibly damaging	0.77
unsettling	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
G1citation:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	31,178,252 (GRCm39)	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	31,203,002 (GRCm39)	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	31,215,325 (GRCm39)	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	31,178,347 (GRCm39)	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31,221,772 (GRCm39)	splice site	probably benign
R1231:Umodl1	UTSW	17	31,178,252 (GRCm39)	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	31,205,478 (GRCm39)	missense	probably benign	0.05
R1459:Umodl1	UTSW	17	31,201,232 (GRCm39)	splice site	probably benign
R1510:Umodl1	UTSW	17	31,178,203 (GRCm39)	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	31,206,942 (GRCm39)	missense	probably benign
R1757:Umodl1	UTSW	17	31,227,674 (GRCm39)	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	31,187,524 (GRCm39)	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	31,201,238 (GRCm39)	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	31,211,128 (GRCm39)	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2903:Umodl1	UTSW	17	31,211,147 (GRCm39)	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	31,208,502 (GRCm39)	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31,221,837 (GRCm39)	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	31,203,763 (GRCm39)	nonsense	probably null
R4207:Umodl1	UTSW	17	31,178,341 (GRCm39)	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	31,207,039 (GRCm39)	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	31,213,789 (GRCm39)	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	31,217,088 (GRCm39)	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	31,202,976 (GRCm39)	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	31,218,175 (GRCm39)	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	31,205,055 (GRCm39)	missense	probably benign
R4993:Umodl1	UTSW	17	31,205,459 (GRCm39)	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	31,203,066 (GRCm39)	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	31,199,333 (GRCm39)	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	31,205,439 (GRCm39)	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	31,201,263 (GRCm39)	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	31,213,761 (GRCm39)	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	31,215,256 (GRCm39)	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31,221,866 (GRCm39)	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	31,201,325 (GRCm39)	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	31,205,121 (GRCm39)	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	31,205,273 (GRCm39)	splice site	probably null
R6822:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
R6999:Umodl1	UTSW	17	31,218,097 (GRCm39)	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	31,201,246 (GRCm39)	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	31,201,318 (GRCm39)	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	31,201,236 (GRCm39)	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	31,205,595 (GRCm39)	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	31,201,306 (GRCm39)	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	31,217,122 (GRCm39)	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7594:Umodl1	UTSW	17	31,173,779 (GRCm39)	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7763:Umodl1	UTSW	17	31,205,430 (GRCm39)	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	31,178,125 (GRCm39)	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	31,192,666 (GRCm39)	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	31,205,361 (GRCm39)	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	31,192,770 (GRCm39)	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	31,190,792 (GRCm39)	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	31,203,806 (GRCm39)	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	31,202,958 (GRCm39)	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	31,192,677 (GRCm39)	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	31,178,147 (GRCm39)	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	31,215,367 (GRCm39)	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	31,217,143 (GRCm39)	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	31,217,152 (GRCm39)	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	31,178,324 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGGGCATCATCAACACCC -3'
(R):5'- CATAAAAGTTTTGCCTCTGACCACC -3'

Sequencing Primer
(F):5'- CAAGGTGTTTTGGGCTGGCC -3'
(R):5'- CTCCAGCATCGATGTGTTCTGTAAG -3'

Posted On

2014-11-12