Incidental Mutation 'R0309:Ago1'
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Nameargonaute RISC catalytic subunit 1
SynonymsEif2c1, argonaute 1
MMRRC Submission 038519-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R0309 (G1)
Quality Score225
Status Validated
Chromosomal Location126435012-126468583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126443166 bp
Amino Acid Change Threonine to Alanine at position 249 (T249A)
Ref Sequence ENSEMBL: ENSMUSP00000134871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: T553A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: T553A

Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156533
Predicted Effect probably benign
Transcript: ENSMUST00000176315
AA Change: T249A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: T249A

Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Meta Mutation Damage Score 0.0791 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,259 D133G possibly damaging Het
Abcb4 A C 5: 8,939,835 D796A probably damaging Het
Actg2 A T 6: 83,519,914 V147E probably damaging Het
Adamts13 A C 2: 26,986,989 T534P probably damaging Het
Ahnak T A 19: 9,002,495 I381N probably damaging Het
Akap9 A G 5: 4,069,038 D3515G probably benign Het
Angptl3 T C 4: 99,034,469 V249A probably benign Het
Ank A G 15: 27,567,572 T294A possibly damaging Het
Ank1 A T 8: 23,104,809 H204L probably damaging Het
Apbb2 A G 5: 66,310,988 probably benign Het
Arhgap28 A T 17: 67,901,429 S15T probably benign Het
Aspm T C 1: 139,482,511 probably benign Het
Atp1a4 T C 1: 172,234,987 E651G probably damaging Het
B3gnt2 A T 11: 22,836,860 F109L probably damaging Het
Bpifb4 T C 2: 153,959,683 F575L probably damaging Het
Calr C A 8: 84,843,031 K322N probably benign Het
Ccdc188 T C 16: 18,219,305 S247P possibly damaging Het
Cdr1 T A X: 61,185,302 D86V unknown Het
Cep97 C T 16: 55,925,058 V48I probably damaging Het
Chaf1b T A 16: 93,884,511 C6S probably damaging Het
Chd3 C T 11: 69,357,018 D920N probably damaging Het
Clk1 T C 1: 58,413,033 probably benign Het
Cntnap3 T A 13: 64,757,436 probably benign Het
Col12a1 T A 9: 79,600,011 probably null Het
Col17a1 G T 19: 47,671,362 probably benign Het
Coq7 T A 7: 118,529,717 I32F possibly damaging Het
Cox6a2 A T 7: 128,205,935 F59I probably damaging Het
Cpq A G 15: 33,594,151 D436G probably damaging Het
Ctso G A 3: 81,944,861 probably null Het
Cxadr A T 16: 78,334,948 H274L probably benign Het
Cyp2c40 A T 19: 39,778,051 C367S possibly damaging Het
Cyp2c70 T G 19: 40,160,671 M344L possibly damaging Het
Defa35 G A 8: 21,065,855 V77I probably benign Het
Dhx57 A G 17: 80,274,881 Y432H probably damaging Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah7a C G 1: 53,405,690 D3952H probably damaging Het
Dnah9 C A 11: 66,026,972 probably benign Het
Dstyk C A 1: 132,456,864 probably benign Het
Efcab2 T A 1: 178,475,904 probably benign Het
Ehbp1l1 T C 19: 5,720,570 E287G possibly damaging Het
Epgn A G 5: 91,032,214 T87A probably benign Het
Erc2 A C 14: 28,141,225 E803A probably damaging Het
Fam26d A G 10: 34,044,047 W75R probably damaging Het
Fer A G 17: 64,139,016 *454W probably null Het
Glyr1 T C 16: 5,031,972 D179G probably damaging Het
Gm12830 T A 4: 114,844,976 probably benign Het
Gm14085 A T 2: 122,517,553 T253S probably benign Het
Gm9922 C A 14: 101,729,693 probably benign Het
Gsta3 C T 1: 21,264,894 P200S possibly damaging Het
Hmgxb3 G A 18: 61,155,128 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il16 T C 7: 83,722,554 K15E probably damaging Het
Kcnip2 T A 19: 45,794,075 probably benign Het
Kdm4c T C 4: 74,345,567 V696A probably benign Het
Kdr A G 5: 75,946,927 probably benign Het
Klhl33 T G 14: 50,891,411 H787P probably damaging Het
Klk14 A T 7: 43,694,345 T159S probably benign Het
Lancl2 A G 6: 57,703,132 N16D probably damaging Het
Lemd3 T C 10: 120,937,110 N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,271,015 probably null Het
Mpl T G 4: 118,446,038 probably benign Het
Myh7b T C 2: 155,630,672 probably benign Het
Mylk A C 16: 34,912,297 probably benign Het
Myof A T 19: 37,981,266 M316K probably benign Het
Nfib T A 4: 82,296,737 N543I probably damaging Het
Nfix A G 8: 84,721,774 S375P probably damaging Het
Nkrf T C X: 36,890,116 Q171R probably damaging Het
Nmnat2 T A 1: 153,077,001 probably benign Het
Npffr2 G A 5: 89,583,347 E379K probably benign Het
Npr2 T C 4: 43,640,904 probably benign Het
Nup98 A C 7: 102,152,428 D212E probably null Het
Nwd2 T C 5: 63,807,218 Y1382H probably damaging Het
Ocstamp T C 2: 165,395,992 R451G possibly damaging Het
Olfr593 T A 7: 103,212,721 I287K probably damaging Het
Olfr804 A G 10: 129,705,139 D87G probably benign Het
Pabpc1 C T 15: 36,597,493 A551T possibly damaging Het
Papd7 A T 13: 69,499,932 V781E possibly damaging Het
Pard3 A T 8: 127,376,897 probably benign Het
Pcdhb12 G T 18: 37,436,121 V107L probably benign Het
Pik3cd A T 4: 149,663,220 V22D probably damaging Het
Pkd1l2 A G 8: 116,997,576 V2396A probably damaging Het
Pnpla7 T C 2: 24,987,195 I167T probably damaging Het
Pphln1 A T 15: 93,441,707 H114L possibly damaging Het
Ppm1h A G 10: 122,920,782 N444S probably damaging Het
Prdm9 G A 17: 15,557,384 T146I probably damaging Het
Prrc2a A G 17: 35,150,915 probably benign Het
Prrx1 T C 1: 163,312,559 D26G possibly damaging Het
Ptpn5 T C 7: 47,079,294 E495G probably damaging Het
Rab23 A C 1: 33,734,861 probably null Het
Ralgps1 C T 2: 33,157,923 M348I probably benign Het
Ranbp2 A G 10: 58,479,868 T2137A probably benign Het
Rapgef4 G T 2: 72,226,030 G654V probably benign Het
Rc3h2 A T 2: 37,379,008 probably benign Het
Reg2 G A 6: 78,406,186 A39T possibly damaging Het
Sema4d C A 13: 51,725,311 V7F probably benign Het
Sgip1 T C 4: 102,915,157 probably benign Het
Sgpl1 C T 10: 61,113,437 probably null Het
Shisa9 G A 16: 11,997,123 V212M probably damaging Het
Shq1 G A 6: 100,573,627 P450L probably benign Het
Sin3a A G 9: 57,110,912 T872A probably benign Het
Sipa1l3 C T 7: 29,348,350 R1371Q probably benign Het
Skint8 T C 4: 111,938,867 V246A probably benign Het
Slc22a20 A T 19: 5,972,957 V386D probably damaging Het
Slc2a7 G A 4: 150,158,071 probably benign Het
Slc35a2 T A X: 7,889,662 Y48N probably damaging Het
Slc4a2 G T 5: 24,434,346 S413I probably damaging Het
Sntg2 T C 12: 30,226,773 T427A probably benign Het
Soat1 T C 1: 156,442,453 Y132C probably damaging Het
Stn1 G T 19: 47,501,673 H342N probably benign Het
Tarbp1 T A 8: 126,438,928 probably benign Het
Tas2r113 A C 6: 132,893,378 K123T probably damaging Het
Tbck C T 3: 132,734,407 Q504* probably null Het
Tenm3 C T 8: 48,341,034 C380Y probably damaging Het
Triobp A G 15: 78,976,540 D1389G probably damaging Het
Trpm4 A T 7: 45,308,706 F780I probably damaging Het
Tubb4a G T 17: 57,081,182 Y281* probably null Het
Txndc15 T C 13: 55,724,582 F261S probably damaging Het
Ube3b T C 5: 114,419,469 probably benign Het
Unc5c G C 3: 141,733,933 V196L probably benign Het
Upf3a G A 8: 13,795,500 probably null Het
Vmn2r20 T C 6: 123,386,104 K574E probably benign Het
Vps50 A G 6: 3,536,853 M275V possibly damaging Het
Xrcc5 A G 1: 72,307,576 probably benign Het
Zbtb18 T C 1: 177,448,616 L505S probably damaging Het
Zbtb41 T C 1: 139,438,984 I567T probably damaging Het
Zfp598 T C 17: 24,678,584 probably benign Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 splice site probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
R7575:Ago1 UTSW 4 126453908 missense probably benign 0.12
R7625:Ago1 UTSW 4 126443229 missense probably benign 0.18
R7988:Ago1 UTSW 4 126460417 missense probably damaging 1.00
R8041:Ago1 UTSW 4 126441936 missense probably damaging 1.00
R8073:Ago1 UTSW 4 126443226 missense probably benign 0.04
R8086:Ago1 UTSW 4 126460981 missense probably benign
R8127:Ago1 UTSW 4 126454421 missense possibly damaging 0.95
R8878:Ago1 UTSW 4 126463723 missense probably benign 0.35
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126453656 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctctctctccctctctccc -3'
Posted On2013-04-16