Incidental Mutation 'R0309:Pik3cd'
ID 25045
Institutional Source Beutler Lab
Gene Symbol Pik3cd
Ensembl Gene ENSMUSG00000039936
Gene Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms 2610208K16Rik, 2410099E07Rik, p110delta
MMRRC Submission 038519-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R0309 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 149733625-149787023 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 149747677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 22 (V22D)
Ref Sequence ENSEMBL: ENSMUSP00000115542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000127273] [ENSMUST00000177654] [ENSMUST00000156309] [ENSMUST00000146612] [ENSMUST00000134534] [ENSMUST00000131224]
AlphaFold O35904
Predicted Effect probably damaging
Transcript: ENSMUST00000038859
AA Change: V22D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 776 1042 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105688
AA Change: V22D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 775 1041 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105689
AA Change: V22D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 684 1.35e-84 SMART
PI3Kc 774 1040 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105690
AA Change: V22D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118704
AA Change: V22D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 687 1.8e-80 SMART
PI3Kc 777 1043 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122059
AA Change: V22D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 408 6.47e-23 SMART
PI3Ka 492 681 8.56e-87 SMART
PI3Kc 771 1037 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127273
AA Change: V22D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119858
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Blast:PI3K_rbd 126 171 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177654
AA Change: V22D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156309
AA Change: V22D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000146612
AA Change: V22D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121843
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134534
AA Change: V22D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118988
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
Pfam:PI3K_p85B 31 62 1.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131224
AA Change: V22D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115542
Gene: ENSMUSG00000039936
AA Change: V22D

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
Meta Mutation Damage Score 0.8533 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,266,271 (GRCm39) D133G possibly damaging Het
Abcb4 A C 5: 8,989,835 (GRCm39) D796A probably damaging Het
Actg2 A T 6: 83,496,896 (GRCm39) V147E probably damaging Het
Adamts13 A C 2: 26,877,001 (GRCm39) T534P probably damaging Het
Ago1 T C 4: 126,336,959 (GRCm39) T249A probably benign Het
Ahnak T A 19: 8,979,859 (GRCm39) I381N probably damaging Het
Akap9 A G 5: 4,119,038 (GRCm39) D3515G probably benign Het
Angptl3 T C 4: 98,922,706 (GRCm39) V249A probably benign Het
Ank A G 15: 27,567,658 (GRCm39) T294A possibly damaging Het
Ank1 A T 8: 23,594,825 (GRCm39) H204L probably damaging Het
Apbb2 A G 5: 66,468,331 (GRCm39) probably benign Het
Arhgap28 A T 17: 68,208,424 (GRCm39) S15T probably benign Het
Aspm T C 1: 139,410,249 (GRCm39) probably benign Het
Atp1a4 T C 1: 172,062,554 (GRCm39) E651G probably damaging Het
B3gnt2 A T 11: 22,786,860 (GRCm39) F109L probably damaging Het
Bpifb4 T C 2: 153,801,603 (GRCm39) F575L probably damaging Het
Calhm4 A G 10: 33,920,043 (GRCm39) W75R probably damaging Het
Calr C A 8: 85,569,660 (GRCm39) K322N probably benign Het
Ccdc188 T C 16: 18,037,169 (GRCm39) S247P possibly damaging Het
Cdr1 T A X: 60,228,908 (GRCm39) D86V unknown Het
Cep97 C T 16: 55,745,421 (GRCm39) V48I probably damaging Het
Chaf1b T A 16: 93,681,399 (GRCm39) C6S probably damaging Het
Chd3 C T 11: 69,247,844 (GRCm39) D920N probably damaging Het
Clk1 T C 1: 58,452,192 (GRCm39) probably benign Het
Cntnap3 T A 13: 64,905,250 (GRCm39) probably benign Het
Col12a1 T A 9: 79,507,293 (GRCm39) probably null Het
Col17a1 G T 19: 47,659,801 (GRCm39) probably benign Het
Coq7 T A 7: 118,128,940 (GRCm39) I32F possibly damaging Het
Cox6a2 A T 7: 127,805,107 (GRCm39) F59I probably damaging Het
Cpq A G 15: 33,594,297 (GRCm39) D436G probably damaging Het
Ctso G A 3: 81,852,168 (GRCm39) probably null Het
Cxadr A T 16: 78,131,836 (GRCm39) H274L probably benign Het
Cyp2c40 A T 19: 39,766,495 (GRCm39) C367S possibly damaging Het
Cyp2c70 T G 19: 40,149,115 (GRCm39) M344L possibly damaging Het
Defa35 G A 8: 21,555,871 (GRCm39) V77I probably benign Het
Dhx57 A G 17: 80,582,310 (GRCm39) Y432H probably damaging Het
Dhx9 A T 1: 153,341,441 (GRCm39) D601E probably benign Het
Dnah7a C G 1: 53,444,849 (GRCm39) D3952H probably damaging Het
Dnah9 C A 11: 65,917,798 (GRCm39) probably benign Het
Dstyk C A 1: 132,384,602 (GRCm39) probably benign Het
Efcab2 T A 1: 178,303,469 (GRCm39) probably benign Het
Ehbp1l1 T C 19: 5,770,598 (GRCm39) E287G possibly damaging Het
Epgn A G 5: 91,180,073 (GRCm39) T87A probably benign Het
Erc2 A C 14: 27,863,182 (GRCm39) E803A probably damaging Het
Fer A G 17: 64,446,011 (GRCm39) *454W probably null Het
Glyr1 T C 16: 4,849,836 (GRCm39) D179G probably damaging Het
Gm12830 T A 4: 114,702,173 (GRCm39) probably benign Het
Gm9922 C A 14: 101,967,129 (GRCm39) probably benign Het
Gsta3 C T 1: 21,335,118 (GRCm39) P200S possibly damaging Het
Hmgxb3 G A 18: 61,288,200 (GRCm39) probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Il16 T C 7: 83,371,762 (GRCm39) K15E probably damaging Het
Kcnip2 T A 19: 45,782,514 (GRCm39) probably benign Het
Kdm4c T C 4: 74,263,804 (GRCm39) V696A probably benign Het
Kdr A G 5: 76,107,587 (GRCm39) probably benign Het
Klhl33 T G 14: 51,128,868 (GRCm39) H787P probably damaging Het
Klk14 A T 7: 43,343,769 (GRCm39) T159S probably benign Het
Lancl2 A G 6: 57,680,117 (GRCm39) N16D probably damaging Het
Lemd3 T C 10: 120,773,015 (GRCm39) N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,489,902 (GRCm39) probably null Het
Mpl T G 4: 118,303,235 (GRCm39) probably benign Het
Myh7b T C 2: 155,472,592 (GRCm39) probably benign Het
Mylk A C 16: 34,732,667 (GRCm39) probably benign Het
Myof A T 19: 37,969,714 (GRCm39) M316K probably benign Het
Nfib T A 4: 82,214,974 (GRCm39) N543I probably damaging Het
Nfix A G 8: 85,448,403 (GRCm39) S375P probably damaging Het
Nkrf T C X: 36,153,769 (GRCm39) Q171R probably damaging Het
Nmnat2 T A 1: 152,952,747 (GRCm39) probably benign Het
Npffr2 G A 5: 89,731,206 (GRCm39) E379K probably benign Het
Npr2 T C 4: 43,640,904 (GRCm39) probably benign Het
Nup98 A C 7: 101,801,635 (GRCm39) D212E probably null Het
Nwd2 T C 5: 63,964,561 (GRCm39) Y1382H probably damaging Het
Ocstamp T C 2: 165,237,912 (GRCm39) R451G possibly damaging Het
Or52s1 T A 7: 102,861,928 (GRCm39) I287K probably damaging Het
Or6c6c A G 10: 129,541,008 (GRCm39) D87G probably benign Het
Pabpc1 C T 15: 36,597,737 (GRCm39) A551T possibly damaging Het
Pard3 A T 8: 128,103,378 (GRCm39) probably benign Het
Pcdhb12 G T 18: 37,569,174 (GRCm39) V107L probably benign Het
Pkd1l2 A G 8: 117,724,315 (GRCm39) V2396A probably damaging Het
Pnpla7 T C 2: 24,877,207 (GRCm39) I167T probably damaging Het
Pphln1 A T 15: 93,339,588 (GRCm39) H114L possibly damaging Het
Ppm1h A G 10: 122,756,687 (GRCm39) N444S probably damaging Het
Prdm9 G A 17: 15,777,646 (GRCm39) T146I probably damaging Het
Prrc2a A G 17: 35,369,891 (GRCm39) probably benign Het
Prrx1 T C 1: 163,140,128 (GRCm39) D26G possibly damaging Het
Ptpn5 T C 7: 46,729,042 (GRCm39) E495G probably damaging Het
Rab23 A C 1: 33,773,942 (GRCm39) probably null Het
Ralgps1 C T 2: 33,047,935 (GRCm39) M348I probably benign Het
Ranbp2 A G 10: 58,315,690 (GRCm39) T2137A probably benign Het
Rapgef4 G T 2: 72,056,374 (GRCm39) G654V probably benign Het
Rc3h2 A T 2: 37,269,020 (GRCm39) probably benign Het
Reg2 G A 6: 78,383,169 (GRCm39) A39T possibly damaging Het
Sema4d C A 13: 51,879,347 (GRCm39) V7F probably benign Het
Sgip1 T C 4: 102,772,354 (GRCm39) probably benign Het
Sgpl1 C T 10: 60,949,216 (GRCm39) probably null Het
Shisa9 G A 16: 11,814,987 (GRCm39) V212M probably damaging Het
Shq1 G A 6: 100,550,588 (GRCm39) P450L probably benign Het
Sin3a A G 9: 57,018,196 (GRCm39) T872A probably benign Het
Sipa1l3 C T 7: 29,047,775 (GRCm39) R1371Q probably benign Het
Skint8 T C 4: 111,796,064 (GRCm39) V246A probably benign Het
Slc22a20 A T 19: 6,022,985 (GRCm39) V386D probably damaging Het
Slc28a2b A T 2: 122,348,034 (GRCm39) T253S probably benign Het
Slc2a7 G A 4: 150,242,528 (GRCm39) probably benign Het
Slc35a2 T A X: 7,755,901 (GRCm39) Y48N probably damaging Het
Slc4a2 G T 5: 24,639,344 (GRCm39) S413I probably damaging Het
Sntg2 T C 12: 30,276,772 (GRCm39) T427A probably benign Het
Soat1 T C 1: 156,270,023 (GRCm39) Y132C probably damaging Het
Stn1 G T 19: 47,490,112 (GRCm39) H342N probably benign Het
Tarbp1 T A 8: 127,165,667 (GRCm39) probably benign Het
Tas2r113 A C 6: 132,870,341 (GRCm39) K123T probably damaging Het
Tbck C T 3: 132,440,168 (GRCm39) Q504* probably null Het
Tenm3 C T 8: 48,794,069 (GRCm39) C380Y probably damaging Het
Tent4a A T 13: 69,648,051 (GRCm39) V781E possibly damaging Het
Triobp A G 15: 78,860,740 (GRCm39) D1389G probably damaging Het
Trpm4 A T 7: 44,958,130 (GRCm39) F780I probably damaging Het
Tubb4a G T 17: 57,388,182 (GRCm39) Y281* probably null Het
Txndc15 T C 13: 55,872,395 (GRCm39) F261S probably damaging Het
Ube3b T C 5: 114,557,530 (GRCm39) probably benign Het
Unc5c G C 3: 141,439,694 (GRCm39) V196L probably benign Het
Upf3a G A 8: 13,845,500 (GRCm39) probably null Het
Vmn2r20 T C 6: 123,363,063 (GRCm39) K574E probably benign Het
Vps50 A G 6: 3,536,853 (GRCm39) M275V possibly damaging Het
Xrcc5 A G 1: 72,346,735 (GRCm39) probably benign Het
Zbtb18 T C 1: 177,276,182 (GRCm39) L505S probably damaging Het
Zbtb41 T C 1: 139,366,722 (GRCm39) I567T probably damaging Het
Zfp598 T C 17: 24,897,558 (GRCm39) probably benign Het
Other mutations in Pik3cd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Pik3cd APN 4 149,741,917 (GRCm39) missense probably damaging 1.00
IGL01536:Pik3cd APN 4 149,737,123 (GRCm39) missense probably damaging 1.00
IGL01636:Pik3cd APN 4 149,738,772 (GRCm39) missense possibly damaging 0.82
IGL02794:Pik3cd APN 4 149,739,028 (GRCm39) missense probably benign
grand_tetons UTSW 4 149,737,156 (GRCm39) missense probably damaging 1.00
Helena UTSW 4 149,736,277 (GRCm39) missense probably damaging 1.00
stinger UTSW 4 149,741,776 (GRCm39) missense probably damaging 1.00
F5770:Pik3cd UTSW 4 149,741,776 (GRCm39) missense probably damaging 1.00
R0003:Pik3cd UTSW 4 149,740,836 (GRCm39) critical splice donor site probably null
R1246:Pik3cd UTSW 4 149,744,257 (GRCm39) missense probably damaging 1.00
R1259:Pik3cd UTSW 4 149,735,105 (GRCm39) nonsense probably null
R1533:Pik3cd UTSW 4 149,739,653 (GRCm39) missense probably damaging 1.00
R1756:Pik3cd UTSW 4 149,743,207 (GRCm39) missense probably benign 0.02
R1796:Pik3cd UTSW 4 149,738,576 (GRCm39) missense possibly damaging 0.83
R1887:Pik3cd UTSW 4 149,737,091 (GRCm39) missense probably damaging 1.00
R1988:Pik3cd UTSW 4 149,747,660 (GRCm39) missense probably damaging 1.00
R2089:Pik3cd UTSW 4 149,737,156 (GRCm39) missense probably damaging 1.00
R2091:Pik3cd UTSW 4 149,737,156 (GRCm39) missense probably damaging 1.00
R4997:Pik3cd UTSW 4 149,743,441 (GRCm39) missense probably damaging 1.00
R5391:Pik3cd UTSW 4 149,743,588 (GRCm39) missense probably damaging 0.98
R5603:Pik3cd UTSW 4 149,743,312 (GRCm39) missense probably benign
R6282:Pik3cd UTSW 4 149,744,200 (GRCm39) missense probably benign 0.00
R6453:Pik3cd UTSW 4 149,736,759 (GRCm39) missense probably damaging 1.00
R7286:Pik3cd UTSW 4 149,744,171 (GRCm39) missense probably benign 0.08
R7423:Pik3cd UTSW 4 149,736,220 (GRCm39) critical splice donor site probably null
R7508:Pik3cd UTSW 4 149,739,040 (GRCm39) missense possibly damaging 0.78
R7665:Pik3cd UTSW 4 149,738,507 (GRCm39) missense possibly damaging 0.70
R7897:Pik3cd UTSW 4 149,741,726 (GRCm39) missense probably benign 0.06
R8039:Pik3cd UTSW 4 149,744,323 (GRCm39) missense possibly damaging 0.91
R8476:Pik3cd UTSW 4 149,736,277 (GRCm39) missense probably damaging 1.00
R9015:Pik3cd UTSW 4 149,740,055 (GRCm39) missense probably benign 0.06
R9252:Pik3cd UTSW 4 149,740,087 (GRCm39) missense possibly damaging 0.88
R9704:Pik3cd UTSW 4 149,739,839 (GRCm39) missense probably benign 0.17
V7580:Pik3cd UTSW 4 149,741,776 (GRCm39) missense probably damaging 1.00
V7581:Pik3cd UTSW 4 149,741,776 (GRCm39) missense probably damaging 1.00
V7582:Pik3cd UTSW 4 149,741,776 (GRCm39) missense probably damaging 1.00
V7583:Pik3cd UTSW 4 149,741,776 (GRCm39) missense probably damaging 1.00
X0023:Pik3cd UTSW 4 149,744,491 (GRCm39) missense probably benign 0.04
Z1176:Pik3cd UTSW 4 149,739,304 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGGTGCCCTGCTCCTGAGAAATG -3'
(R):5'- TGTAGCAAGCTTTGCATGTCCTCC -3'

Sequencing Primer
(F):5'- TGCTCCTGAGAAATGGCAGC -3'
(R):5'- GCATGTCCTCCTGTGGC -3'
Posted On 2013-04-16