Incidental Mutation 'R2432:Ptprk'
ID250456
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 040393-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2432 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28592844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1408 (V1408E)
Ref Sequence ENSEMBL: ENSMUSP00000151986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359] [ENSMUST00000220357]
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: V1420E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: V1420E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: V1434E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: V1408E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220404
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,451,333 probably benign Het
Adamts6 A T 13: 104,426,977 Y659F probably benign Het
Adamts9 C A 6: 92,857,900 G750W probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Aspscr1 A G 11: 120,702,566 probably benign Het
Calr3 A G 8: 72,438,426 probably benign Het
Cpt2 A T 4: 107,904,526 Y126* probably null Het
Cyp2d34 A G 15: 82,619,011 L94P probably damaging Het
Def6 A T 17: 28,228,069 D558V probably benign Het
Dnase1l2 G A 17: 24,442,725 T20I possibly damaging Het
Eif5b A G 1: 38,019,342 K242E unknown Het
Golim4 T C 3: 75,891,942 N478S possibly damaging Het
Helb A T 10: 120,105,537 D415E probably benign Het
Ifna12 T A 4: 88,603,353 probably benign Het
Jhy T A 9: 40,960,886 H109L probably benign Het
Krt83 A T 15: 101,488,156 Y241* probably null Het
Macf1 G T 4: 123,683,996 A65E probably damaging Het
Mug2 C A 6: 122,084,376 N1418K possibly damaging Het
Myo1f A G 17: 33,575,849 D21G probably damaging Het
Myo5a T A 9: 75,212,873 I1651N possibly damaging Het
Notch3 A T 17: 32,153,804 C598S probably damaging Het
Npat A T 9: 53,558,135 H307L probably damaging Het
Nr1h2 T C 7: 44,551,367 Q279R possibly damaging Het
Olfr1302 T C 2: 111,780,671 V117A probably benign Het
Olfr804 A G 10: 129,704,925 T16A possibly damaging Het
Pcdhb16 A T 18: 37,479,930 N648Y probably damaging Het
Pdzrn3 G T 6: 101,150,791 S971R probably damaging Het
Plch2 A G 4: 154,986,164 *494Q probably null Het
Plekhg4 T A 8: 105,381,836 D1170E probably benign Het
Plekhm3 A G 1: 64,937,856 S152P probably damaging Het
Ppargc1b G A 18: 61,307,799 P683S possibly damaging Het
Prdm12 T G 2: 31,651,852 M191R probably benign Het
Prdm14 T C 1: 13,125,633 D68G probably benign Het
Prp2 C T 6: 132,599,911 P54S unknown Het
Prpf4b A G 13: 34,883,341 probably benign Het
Rap1gds1 A G 3: 138,956,250 M415T probably damaging Het
Rps6ka5 A G 12: 100,554,405 F621S probably damaging Het
Rrm1 T A 7: 102,443,072 D35E probably benign Het
Rxfp3 T C 15: 11,036,140 H382R probably damaging Het
Slc11a1 A G 1: 74,383,751 probably benign Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc30a3 T C 5: 31,088,694 S231G probably damaging Het
Slc44a2 A T 9: 21,344,834 I274F probably damaging Het
Tas2r119 A G 15: 32,178,019 I244V possibly damaging Het
Tenm2 C A 11: 36,027,191 R1914L probably damaging Het
Tfdp2 T C 9: 96,310,590 M242T probably damaging Het
Tmprss6 A G 15: 78,465,104 probably benign Het
Ttc6 C T 12: 57,622,035 P421L possibly damaging Het
Usp16 T A 16: 87,466,358 probably null Het
Usp40 T C 1: 87,982,082 E550G probably benign Het
Vmn2r28 T C 7: 5,488,702 Y182C probably damaging Het
Zfp382 A G 7: 30,133,749 D275G probably benign Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCTGAGAGAACTTCATCCTC -3'
(R):5'- CCAGCAAGTTTCATGTGCAC -3'

Sequencing Primer
(F):5'- GAGAGAACTTCATCCTCTAGTATCC -3'
(R):5'- GCAAGTTTCATGTGCACATCTGAC -3'
Posted On2014-11-12