Incidental Mutation 'R2432:Cyp2d34'
ID250469
Institutional Source Beutler Lab
Gene Symbol Cyp2d34
Ensembl Gene ENSMUSG00000094559
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 34
Synonyms
MMRRC Submission 040393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2432 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82615965-82620946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82619011 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 94 (L94P)
Ref Sequence ENSEMBL: ENSMUSP00000105141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109515] [ENSMUST00000229833]
Predicted Effect probably damaging
Transcript: ENSMUST00000109515
AA Change: L94P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105141
Gene: ENSMUSG00000094559
AA Change: L94P

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 3.2e-141 PFAM
Predicted Effect silent
Transcript: ENSMUST00000229833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231012
Meta Mutation Damage Score 0.516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,451,333 probably benign Het
Adamts6 A T 13: 104,426,977 Y659F probably benign Het
Adamts9 C A 6: 92,857,900 G750W probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Aspscr1 A G 11: 120,702,566 probably benign Het
Calr3 A G 8: 72,438,426 probably benign Het
Cpt2 A T 4: 107,904,526 Y126* probably null Het
Def6 A T 17: 28,228,069 D558V probably benign Het
Dnase1l2 G A 17: 24,442,725 T20I possibly damaging Het
Eif5b A G 1: 38,019,342 K242E unknown Het
Golim4 T C 3: 75,891,942 N478S possibly damaging Het
Helb A T 10: 120,105,537 D415E probably benign Het
Ifna12 T A 4: 88,603,353 probably benign Het
Jhy T A 9: 40,960,886 H109L probably benign Het
Krt83 A T 15: 101,488,156 Y241* probably null Het
Macf1 G T 4: 123,683,996 A65E probably damaging Het
Mug2 C A 6: 122,084,376 N1418K possibly damaging Het
Myo1f A G 17: 33,575,849 D21G probably damaging Het
Myo5a T A 9: 75,212,873 I1651N possibly damaging Het
Notch3 A T 17: 32,153,804 C598S probably damaging Het
Npat A T 9: 53,558,135 H307L probably damaging Het
Nr1h2 T C 7: 44,551,367 Q279R possibly damaging Het
Olfr1302 T C 2: 111,780,671 V117A probably benign Het
Olfr804 A G 10: 129,704,925 T16A possibly damaging Het
Pcdhb16 A T 18: 37,479,930 N648Y probably damaging Het
Pdzrn3 G T 6: 101,150,791 S971R probably damaging Het
Plch2 A G 4: 154,986,164 *494Q probably null Het
Plekhg4 T A 8: 105,381,836 D1170E probably benign Het
Plekhm3 A G 1: 64,937,856 S152P probably damaging Het
Ppargc1b G A 18: 61,307,799 P683S possibly damaging Het
Prdm12 T G 2: 31,651,852 M191R probably benign Het
Prdm14 T C 1: 13,125,633 D68G probably benign Het
Prp2 C T 6: 132,599,911 P54S unknown Het
Prpf4b A G 13: 34,883,341 probably benign Het
Ptprk T A 10: 28,592,844 V1408E probably damaging Het
Rap1gds1 A G 3: 138,956,250 M415T probably damaging Het
Rps6ka5 A G 12: 100,554,405 F621S probably damaging Het
Rrm1 T A 7: 102,443,072 D35E probably benign Het
Rxfp3 T C 15: 11,036,140 H382R probably damaging Het
Slc11a1 A G 1: 74,383,751 probably benign Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc30a3 T C 5: 31,088,694 S231G probably damaging Het
Slc44a2 A T 9: 21,344,834 I274F probably damaging Het
Tas2r119 A G 15: 32,178,019 I244V possibly damaging Het
Tenm2 C A 11: 36,027,191 R1914L probably damaging Het
Tfdp2 T C 9: 96,310,590 M242T probably damaging Het
Tmprss6 A G 15: 78,465,104 probably benign Het
Ttc6 C T 12: 57,622,035 P421L possibly damaging Het
Usp16 T A 16: 87,466,358 probably null Het
Usp40 T C 1: 87,982,082 E550G probably benign Het
Vmn2r28 T C 7: 5,488,702 Y182C probably damaging Het
Zfp382 A G 7: 30,133,749 D275G probably benign Het
Other mutations in Cyp2d34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Cyp2d34 APN 15 82617535 missense probably damaging 0.96
IGL00914:Cyp2d34 APN 15 82620714 missense probably damaging 0.98
IGL01347:Cyp2d34 APN 15 82616777 missense possibly damaging 0.89
IGL01354:Cyp2d34 APN 15 82617622 missense probably benign 0.00
IGL01681:Cyp2d34 APN 15 82617131 critical splice donor site probably null
IGL01733:Cyp2d34 APN 15 82618660 missense possibly damaging 0.73
IGL02231:Cyp2d34 APN 15 82618606 missense probably benign 0.44
IGL02425:Cyp2d34 APN 15 82618279 missense probably benign
IGL03219:Cyp2d34 APN 15 82618539 missense probably benign 0.01
R0684:Cyp2d34 UTSW 15 82617550 missense probably benign 0.06
R0811:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R0812:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R1617:Cyp2d34 UTSW 15 82620845 missense probably benign 0.21
R1756:Cyp2d34 UTSW 15 82617524 missense probably damaging 1.00
R1827:Cyp2d34 UTSW 15 82616094 missense probably benign 0.00
R1962:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R2102:Cyp2d34 UTSW 15 82616773 missense probably benign 0.17
R2113:Cyp2d34 UTSW 15 82617616 missense probably damaging 1.00
R2566:Cyp2d34 UTSW 15 82616167 missense probably damaging 1.00
R3154:Cyp2d34 UTSW 15 82617566 missense probably benign 0.04
R3834:Cyp2d34 UTSW 15 82616746 critical splice donor site probably null
R3881:Cyp2d34 UTSW 15 82618617 missense probably benign 0.00
R4022:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R4181:Cyp2d34 UTSW 15 82617285 splice site probably null
R4613:Cyp2d34 UTSW 15 82616325 missense probably damaging 0.98
R4636:Cyp2d34 UTSW 15 82620728 missense probably damaging 1.00
R4695:Cyp2d34 UTSW 15 82616891 missense probably benign
R4993:Cyp2d34 UTSW 15 82618329 missense probably damaging 1.00
R5262:Cyp2d34 UTSW 15 82618371 missense probably damaging 1.00
R5402:Cyp2d34 UTSW 15 82619086 missense probably damaging 1.00
R5772:Cyp2d34 UTSW 15 82617140 missense probably null 0.24
R5874:Cyp2d34 UTSW 15 82619042 missense probably benign 0.04
R6051:Cyp2d34 UTSW 15 82616770 missense probably damaging 1.00
R6057:Cyp2d34 UTSW 15 82616351 missense probably benign
R6143:Cyp2d34 UTSW 15 82620776 missense probably benign 0.25
R6452:Cyp2d34 UTSW 15 82616089 missense probably benign 0.00
R7296:Cyp2d34 UTSW 15 82617235 missense possibly damaging 0.87
R7391:Cyp2d34 UTSW 15 82618386 missense probably benign 0.14
R7398:Cyp2d34 UTSW 15 82616763 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAATCCAGCGCATGCCTTC -3'
(R):5'- ACAATGGTTGTGCAGTGAGC -3'

Sequencing Primer
(F):5'- AGTCATCCTGGATTTCAGTGAC -3'
(R):5'- GCAGTGAGCTTAGTTCTATGGTC -3'
Posted On2014-11-12