Incidental Mutation 'R2432:Krt83'
ID250470
Institutional Source Beutler Lab
Gene Symbol Krt83
Ensembl Gene ENSMUSG00000047641
Gene Namekeratin 83
SynonymsKrt2-25
MMRRC Submission 040393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2432 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101431490-101438804 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 101488156 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 241 (Y241*)
Ref Sequence ENSEMBL: ENSMUSP00000023718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023718]
Predicted Effect probably null
Transcript: ENSMUST00000023718
AA Change: Y241*
SMART Domains Protein: ENSMUSP00000023718
Gene: ENSMUSG00000067613
AA Change: Y241*

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 100 5.9e-16 PFAM
Filament 103 414 7.02e-149 SMART
low complexity region 422 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230173
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,451,333 probably benign Het
Adamts6 A T 13: 104,426,977 Y659F probably benign Het
Adamts9 C A 6: 92,857,900 G750W probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Aspscr1 A G 11: 120,702,566 probably benign Het
Calr3 A G 8: 72,438,426 probably benign Het
Cpt2 A T 4: 107,904,526 Y126* probably null Het
Cyp2d34 A G 15: 82,619,011 L94P probably damaging Het
Def6 A T 17: 28,228,069 D558V probably benign Het
Dnase1l2 G A 17: 24,442,725 T20I possibly damaging Het
Eif5b A G 1: 38,019,342 K242E unknown Het
Golim4 T C 3: 75,891,942 N478S possibly damaging Het
Helb A T 10: 120,105,537 D415E probably benign Het
Ifna12 T A 4: 88,603,353 probably benign Het
Jhy T A 9: 40,960,886 H109L probably benign Het
Macf1 G T 4: 123,683,996 A65E probably damaging Het
Mug2 C A 6: 122,084,376 N1418K possibly damaging Het
Myo1f A G 17: 33,575,849 D21G probably damaging Het
Myo5a T A 9: 75,212,873 I1651N possibly damaging Het
Notch3 A T 17: 32,153,804 C598S probably damaging Het
Npat A T 9: 53,558,135 H307L probably damaging Het
Nr1h2 T C 7: 44,551,367 Q279R possibly damaging Het
Olfr1302 T C 2: 111,780,671 V117A probably benign Het
Olfr804 A G 10: 129,704,925 T16A possibly damaging Het
Pcdhb16 A T 18: 37,479,930 N648Y probably damaging Het
Pdzrn3 G T 6: 101,150,791 S971R probably damaging Het
Plch2 A G 4: 154,986,164 *494Q probably null Het
Plekhg4 T A 8: 105,381,836 D1170E probably benign Het
Plekhm3 A G 1: 64,937,856 S152P probably damaging Het
Ppargc1b G A 18: 61,307,799 P683S possibly damaging Het
Prdm12 T G 2: 31,651,852 M191R probably benign Het
Prdm14 T C 1: 13,125,633 D68G probably benign Het
Prp2 C T 6: 132,599,911 P54S unknown Het
Prpf4b A G 13: 34,883,341 probably benign Het
Ptprk T A 10: 28,592,844 V1408E probably damaging Het
Rap1gds1 A G 3: 138,956,250 M415T probably damaging Het
Rps6ka5 A G 12: 100,554,405 F621S probably damaging Het
Rrm1 T A 7: 102,443,072 D35E probably benign Het
Rxfp3 T C 15: 11,036,140 H382R probably damaging Het
Slc11a1 A G 1: 74,383,751 probably benign Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc30a3 T C 5: 31,088,694 S231G probably damaging Het
Slc44a2 A T 9: 21,344,834 I274F probably damaging Het
Tas2r119 A G 15: 32,178,019 I244V possibly damaging Het
Tenm2 C A 11: 36,027,191 R1914L probably damaging Het
Tfdp2 T C 9: 96,310,590 M242T probably damaging Het
Tmprss6 A G 15: 78,465,104 probably benign Het
Ttc6 C T 12: 57,622,035 P421L possibly damaging Het
Usp16 T A 16: 87,466,358 probably null Het
Usp40 T C 1: 87,982,082 E550G probably benign Het
Vmn2r28 T C 7: 5,488,702 Y182C probably damaging Het
Zfp382 A G 7: 30,133,749 D275G probably benign Het
Other mutations in Krt83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Krt83 APN 15 101488211 missense probably benign 0.17
IGL01315:Krt83 APN 15 101486967 splice site probably benign
IGL01702:Krt83 APN 15 101491218 missense probably benign 0.18
IGL02123:Krt83 APN 15 101487585 missense possibly damaging 0.49
IGL02353:Krt83 APN 15 101485458 missense probably benign
IGL02360:Krt83 APN 15 101485458 missense probably benign
IGL02395:Krt83 APN 15 101487952 missense probably benign 0.18
IGL02633:Krt83 APN 15 101491214 missense probably damaging 1.00
R0357:Krt83 UTSW 15 101487019 missense probably benign 0.17
R0650:Krt83 UTSW 15 101487040 missense probably damaging 0.99
R0928:Krt83 UTSW 15 101491280 missense probably benign 0.00
R1126:Krt83 UTSW 15 101487482 missense probably damaging 0.98
R1196:Krt83 UTSW 15 101491433 missense probably benign 0.03
R1252:Krt83 UTSW 15 101487830 missense probably damaging 1.00
R1513:Krt83 UTSW 15 101489657 missense probably benign 0.30
R1612:Krt83 UTSW 15 101488211 missense probably benign 0.17
R1870:Krt83 UTSW 15 101487190 missense probably benign
R2173:Krt83 UTSW 15 101487937 missense probably damaging 0.98
R2568:Krt83 UTSW 15 101487827 missense possibly damaging 0.67
R2696:Krt83 UTSW 15 101487009 missense probably benign 0.01
R3508:Krt83 UTSW 15 101488158 missense probably benign 0.04
R4364:Krt83 UTSW 15 101487514 missense probably benign
R4366:Krt83 UTSW 15 101487514 missense probably benign
R4606:Krt83 UTSW 15 101487049 missense probably benign 0.18
R4721:Krt83 UTSW 15 101487982 missense probably damaging 1.00
R4784:Krt83 UTSW 15 101487956 missense probably damaging 1.00
R4987:Krt83 UTSW 15 101487009 missense probably benign
R5008:Krt83 UTSW 15 101491224 missense probably damaging 1.00
R5101:Krt83 UTSW 15 101487510 missense probably benign 0.14
R5367:Krt83 UTSW 15 101486994 missense probably damaging 1.00
R5516:Krt83 UTSW 15 101487121 nonsense probably null
R5949:Krt83 UTSW 15 101487595 missense probably damaging 0.99
R5972:Krt83 UTSW 15 101487586 missense probably benign
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6135:Krt83 UTSW 15 101487534 missense probably damaging 1.00
R7151:Krt83 UTSW 15 101489648 missense probably damaging 1.00
R7186:Krt83 UTSW 15 101487202 splice site probably null
R7297:Krt83 UTSW 15 101489647 missense probably benign 0.42
R7708:Krt83 UTSW 15 101487932 missense probably benign 0.00
R7796:Krt83 UTSW 15 101485984 missense possibly damaging 0.95
R8172:Krt83 UTSW 15 101485403 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CGGCTGTTGTCCATCTTGAC -3'
(R):5'- TAAAGCTAGTCCCTGCCCAG -3'

Sequencing Primer
(F):5'- AATGGAGGATGCGGGTCTCC -3'
(R):5'- AGTCCCTGCCCAGTTCCAC -3'
Posted On2014-11-12