Incidental Mutation 'R2432:Def6'
ID250473
Institutional Source Beutler Lab
Gene Symbol Def6
Ensembl Gene ENSMUSG00000002257
Gene Namedifferentially expressed in FDCP 6
SynonymsIBP, SLAT, 6430538D02Rik, IRF-4-binding protein, 2410003F05Rik
MMRRC Submission 040393-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2432 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28207778-28228608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28228069 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 558 (D558V)
Ref Sequence ENSEMBL: ENSMUSP00000002327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002320] [ENSMUST00000002327]
Predicted Effect probably benign
Transcript: ENSMUST00000002320
SMART Domains Protein: ENSMUSP00000002320
Gene: ENSMUSG00000002250

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Blast:HOLI 183 208 1e-6 BLAST
HOLI 250 409 1.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000002327
AA Change: D558V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000002327
Gene: ENSMUSG00000002257
AA Change: D558V

DomainStartEndE-ValueType
low complexity region 145 166 N/A INTRINSIC
PH 217 314 3.87e-20 SMART
coiled coil region 318 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166744
Meta Mutation Damage Score 0.0905 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants spontaneously develop systemic autoimmunity. Females primarily are affected, displaying hypergammaglobulinemia, accumulation of effector/memory T cells and IgG+ B cells, and production of autoantibodies [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,451,333 probably benign Het
Adamts6 A T 13: 104,426,977 Y659F probably benign Het
Adamts9 C A 6: 92,857,900 G750W probably damaging Het
Adgrv1 GA GAA 13: 81,540,132 probably null Het
Aspscr1 A G 11: 120,702,566 probably benign Het
Calr3 A G 8: 72,438,426 probably benign Het
Cpt2 A T 4: 107,904,526 Y126* probably null Het
Cyp2d34 A G 15: 82,619,011 L94P probably damaging Het
Dnase1l2 G A 17: 24,442,725 T20I possibly damaging Het
Eif5b A G 1: 38,019,342 K242E unknown Het
Golim4 T C 3: 75,891,942 N478S possibly damaging Het
Helb A T 10: 120,105,537 D415E probably benign Het
Ifna12 T A 4: 88,603,353 probably benign Het
Jhy T A 9: 40,960,886 H109L probably benign Het
Krt83 A T 15: 101,488,156 Y241* probably null Het
Macf1 G T 4: 123,683,996 A65E probably damaging Het
Mug2 C A 6: 122,084,376 N1418K possibly damaging Het
Myo1f A G 17: 33,575,849 D21G probably damaging Het
Myo5a T A 9: 75,212,873 I1651N possibly damaging Het
Notch3 A T 17: 32,153,804 C598S probably damaging Het
Npat A T 9: 53,558,135 H307L probably damaging Het
Nr1h2 T C 7: 44,551,367 Q279R possibly damaging Het
Olfr1302 T C 2: 111,780,671 V117A probably benign Het
Olfr804 A G 10: 129,704,925 T16A possibly damaging Het
Pcdhb16 A T 18: 37,479,930 N648Y probably damaging Het
Pdzrn3 G T 6: 101,150,791 S971R probably damaging Het
Plch2 A G 4: 154,986,164 *494Q probably null Het
Plekhg4 T A 8: 105,381,836 D1170E probably benign Het
Plekhm3 A G 1: 64,937,856 S152P probably damaging Het
Ppargc1b G A 18: 61,307,799 P683S possibly damaging Het
Prdm12 T G 2: 31,651,852 M191R probably benign Het
Prdm14 T C 1: 13,125,633 D68G probably benign Het
Prp2 C T 6: 132,599,911 P54S unknown Het
Prpf4b A G 13: 34,883,341 probably benign Het
Ptprk T A 10: 28,592,844 V1408E probably damaging Het
Rap1gds1 A G 3: 138,956,250 M415T probably damaging Het
Rps6ka5 A G 12: 100,554,405 F621S probably damaging Het
Rrm1 T A 7: 102,443,072 D35E probably benign Het
Rxfp3 T C 15: 11,036,140 H382R probably damaging Het
Slc11a1 A G 1: 74,383,751 probably benign Het
Slc25a13 A T 6: 6,114,017 M285K probably benign Het
Slc30a3 T C 5: 31,088,694 S231G probably damaging Het
Slc44a2 A T 9: 21,344,834 I274F probably damaging Het
Tas2r119 A G 15: 32,178,019 I244V possibly damaging Het
Tenm2 C A 11: 36,027,191 R1914L probably damaging Het
Tfdp2 T C 9: 96,310,590 M242T probably damaging Het
Tmprss6 A G 15: 78,465,104 probably benign Het
Ttc6 C T 12: 57,622,035 P421L possibly damaging Het
Usp16 T A 16: 87,466,358 probably null Het
Usp40 T C 1: 87,982,082 E550G probably benign Het
Vmn2r28 T C 7: 5,488,702 Y182C probably damaging Het
Zfp382 A G 7: 30,133,749 D275G probably benign Het
Other mutations in Def6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Def6 APN 17 28219740 splice site probably benign
IGL01619:Def6 APN 17 28207864 missense probably damaging 1.00
IGL01737:Def6 APN 17 28223727 missense possibly damaging 0.94
IGL02550:Def6 APN 17 28228261 missense probably benign 0.03
R0013:Def6 UTSW 17 28217092 missense probably damaging 1.00
R0335:Def6 UTSW 17 28228069 missense possibly damaging 0.83
R0357:Def6 UTSW 17 28223935 missense probably damaging 1.00
R0373:Def6 UTSW 17 28220180 missense probably damaging 0.96
R1161:Def6 UTSW 17 28217619 missense probably benign 0.00
R1310:Def6 UTSW 17 28217619 missense probably benign 0.00
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1636:Def6 UTSW 17 28223918 missense possibly damaging 0.95
R1778:Def6 UTSW 17 28220186 missense probably benign 0.02
R3881:Def6 UTSW 17 28220215 missense probably damaging 1.00
R4402:Def6 UTSW 17 28219976 missense probably damaging 0.99
R4589:Def6 UTSW 17 28228147 missense probably benign
R4683:Def6 UTSW 17 28217635 missense probably damaging 0.99
R5704:Def6 UTSW 17 28228226 missense probably benign
R6481:Def6 UTSW 17 28226163 missense probably benign 0.00
R6805:Def6 UTSW 17 28223717 missense probably damaging 1.00
R7029:Def6 UTSW 17 28225969 missense probably benign 0.05
R7863:Def6 UTSW 17 28227867 missense possibly damaging 0.62
R8229:Def6 UTSW 17 28217755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGAACAGGCTCATGCATC -3'
(R):5'- TCTTCCTGAGAGGCCAAAGC -3'

Sequencing Primer
(F):5'- TCATGCATCCGATCGAGC -3'
(R):5'- CAAAGCTAGGATGGGAGTCTCATCTC -3'
Posted On2014-11-12