Mutagenetix > Incidental Mutation

Incidental Mutation 'R2433:Myo5b'

250509

Institutional Source

Beutler Lab

Gene Symbol

Myo5b

Ensembl Gene

ENSMUSG00000025885

Gene Name

myosin VB

Synonyms

MMRRC Submission

040394-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.716) question?

Stock #

R2433 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74440936-74771493 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74759087 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1634 (Y1634C)

Ref Sequence

ENSEMBL: ENSMUSP00000112728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000074157
AA Change: Y1608C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: Y1608C

Domain	Start	End	E-Value	Type
MYSc	63	763	N/A	SMART
IQ	764	786	2.41e-4	SMART
IQ	787	809	7.7e-3	SMART
IQ	812	834	2.18e-2	SMART
IQ	835	857	1.72e0	SMART
IQ	860	882	7.52e-6	SMART
IQ	883	905	4.12e-3	SMART
low complexity region	1053	1065	N/A	INTRINSIC
coiled coil region	1140	1261	N/A	INTRINSIC
coiled coil region	1311	1415	N/A	INTRINSIC
DIL	1650	1755	7.48e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121875
AA Change: Y1634C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: Y1634C

Domain	Start	End	E-Value	Type
MYSc	63	763	N/A	SMART
IQ	764	786	2.41e-4	SMART
IQ	787	809	7.7e-3	SMART
IQ	812	834	2.18e-2	SMART
IQ	835	857	1.72e0	SMART
IQ	860	882	7.52e-6	SMART
IQ	883	905	4.12e-3	SMART
low complexity region	1053	1065	N/A	INTRINSIC
coiled coil region	1140	1261	N/A	INTRINSIC
coiled coil region	1332	1441	N/A	INTRINSIC
DIL	1676	1781	7.48e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154986

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp6v0a4	A	G	6: 38,082,029		probably null	Het
Bpifb4	A	G	2: 153,959,677	K573E	probably damaging	Het
Capn10	T	A	1: 92,942,525	D244E	probably benign	Het
Dhrs11	C	A	11: 84,828,919		probably benign	Het
Eipr1	G	A	12: 28,863,043	G248R	probably damaging	Het
Fam120a	A	C	13: 48,933,968	D305E	probably damaging	Het
Hmgcr	A	G	13: 96,665,885	L97P	probably damaging	Het
Htt	A	T	5: 34,907,541	S3033C	possibly damaging	Het
Igkv10-94	T	C	6: 68,704,575	T94A	probably benign	Het
Krtap16-3	T	C	16: 88,962,645	Y60C	unknown	Het
Lrp4	G	A	2: 91,506,015	V1724I	probably benign	Het
Nrxn3	A	G	12: 89,976,392	Y96C	probably damaging	Het
Obscn	A	T	11: 59,039,086		probably null	Het
Pde3b	T	C	7: 114,526,837	C769R	probably benign	Het
Phlpp2	T	G	8: 109,940,002	C1054W	probably damaging	Het
Pttg1	A	T	11: 43,420,351	V193D	probably damaging	Het
Robo1	T	C	16: 72,970,239	L433S	probably benign	Het
Sema4f	A	T	6: 82,939,509	C13S	possibly damaging	Het
Slc12a3	T	C	8: 94,346,316	L689P	probably benign	Het
Slc7a6os	T	C	8: 106,204,371	N211S	possibly damaging	Het
Smurf2	T	A	11: 106,868,664	I69F	probably benign	Het
St8sia3	A	T	18: 64,269,716	H198L	probably benign	Het
Tacc3	A	G	5: 33,671,739	K594R	possibly damaging	Het
Trip12	A	T	1: 84,743,823	I1396K	possibly damaging	Het
Ugcg	A	G	4: 59,207,876	T72A	possibly damaging	Het
Zfp944	A	T	17: 22,339,212	Y351*	probably null	Het

Other mutations in Myo5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00798:Myo5b	APN	18	74654076	splice site	probably benign
IGL01083:Myo5b	APN	18	74733903	splice site	probably benign
IGL01448:Myo5b	APN	18	74644090	missense	probably damaging	0.97
IGL01516:Myo5b	APN	18	74627195	missense	probably damaging	0.99
IGL01525:Myo5b	APN	18	74740549	missense	probably damaging	1.00
IGL01873:Myo5b	APN	18	74580396	missense	probably damaging	1.00
IGL01887:Myo5b	APN	18	74714936	missense	probably benign	0.41
IGL01953:Myo5b	APN	18	74569767	missense	possibly damaging	0.62
IGL01976:Myo5b	APN	18	74698277	missense	probably damaging	1.00
IGL02017:Myo5b	APN	18	74716999	missense	probably damaging	1.00
IGL02331:Myo5b	APN	18	74638040	critical splice acceptor site	probably null
IGL02624:Myo5b	APN	18	74714939	missense	probably damaging	0.98
IGL02707:Myo5b	APN	18	74695367	splice site	probably benign
IGL02806:Myo5b	APN	18	74617080	critical splice donor site	probably null
IGL03009:Myo5b	APN	18	74760968	missense	possibly damaging	0.54
IGL03061:Myo5b	APN	18	74634559	missense	probably benign	0.02
IGL03061:Myo5b	APN	18	74580544	splice site	probably benign
unrat	UTSW	18	74653361	missense	possibly damaging	0.93
BB007:Myo5b	UTSW	18	74731754	missense	probably benign
BB017:Myo5b	UTSW	18	74731754	missense	probably benign
R0085:Myo5b	UTSW	18	74701680	missense	probably benign	0.21
R0114:Myo5b	UTSW	18	74742171	missense	probably benign	0.03
R0226:Myo5b	UTSW	18	74742180	missense	probably benign
R0242:Myo5b	UTSW	18	74661716	missense	possibly damaging	0.95
R0242:Myo5b	UTSW	18	74661716	missense	possibly damaging	0.95
R0471:Myo5b	UTSW	18	74728954	splice site	probably benign
R0494:Myo5b	UTSW	18	74653967	missense	probably damaging	1.00
R0920:Myo5b	UTSW	18	74625641	missense	probably benign	0.09
R1144:Myo5b	UTSW	18	74625587	missense	probably damaging	1.00
R1177:Myo5b	UTSW	18	74644072	missense	probably damaging	1.00
R1387:Myo5b	UTSW	18	74644201	splice site	probably benign
R1468:Myo5b	UTSW	18	74740503	missense	probably damaging	0.99
R1468:Myo5b	UTSW	18	74740503	missense	probably damaging	0.99
R1555:Myo5b	UTSW	18	74569782	missense	probably damaging	1.00
R1587:Myo5b	UTSW	18	74733990	missense	probably benign
R1600:Myo5b	UTSW	18	74713540	unclassified	probably benign
R1639:Myo5b	UTSW	18	74707916	missense	probably benign	0.19
R1779:Myo5b	UTSW	18	74742147	missense	probably benign	0.06
R1806:Myo5b	UTSW	18	74577609	missense	possibly damaging	0.91
R1929:Myo5b	UTSW	18	74733925	missense	probably damaging	0.99
R2046:Myo5b	UTSW	18	74577455	missense	probably benign	0.28
R2093:Myo5b	UTSW	18	74759192	missense	probably damaging	0.98
R2270:Myo5b	UTSW	18	74733925	missense	probably damaging	0.99
R2272:Myo5b	UTSW	18	74733925	missense	probably damaging	0.99
R2298:Myo5b	UTSW	18	74625605	missense	probably damaging	1.00
R2888:Myo5b	UTSW	18	74762618	missense	probably damaging	1.00
R3824:Myo5b	UTSW	18	74661655	missense	probably benign	0.41
R3937:Myo5b	UTSW	18	74716037	missense	probably damaging	0.98
R3938:Myo5b	UTSW	18	74716037	missense	probably damaging	0.98
R3947:Myo5b	UTSW	18	74695403	missense	probably damaging	1.00
R3971:Myo5b	UTSW	18	74740527	missense	probably damaging	1.00
R3972:Myo5b	UTSW	18	74740527	missense	probably damaging	1.00
R3974:Myo5b	UTSW	18	74634481	missense	probably damaging	1.00
R4027:Myo5b	UTSW	18	74759240	missense	possibly damaging	0.67
R4080:Myo5b	UTSW	18	74740488	missense	probably benign
R4285:Myo5b	UTSW	18	74714849	missense	probably benign
R4308:Myo5b	UTSW	18	74731740	missense	possibly damaging	0.89
R4411:Myo5b	UTSW	18	74698274	missense	possibly damaging	0.89
R4415:Myo5b	UTSW	18	74580408	missense	probably damaging	1.00
R4516:Myo5b	UTSW	18	74625674	missense	probably damaging	1.00
R4690:Myo5b	UTSW	18	74722462	missense	probably damaging	0.97
R4781:Myo5b	UTSW	18	74744681	missense	possibly damaging	0.80
R4786:Myo5b	UTSW	18	74695380	missense	probably benign	0.01
R4796:Myo5b	UTSW	18	74744630	missense	possibly damaging	0.68
R4924:Myo5b	UTSW	18	74695384	missense	probably benign	0.19
R4972:Myo5b	UTSW	18	74627193	missense	probably damaging	0.98
R5004:Myo5b	UTSW	18	74744773	critical splice donor site	probably null
R5024:Myo5b	UTSW	18	74716034	missense	possibly damaging	0.90
R5043:Myo5b	UTSW	18	74638153	critical splice donor site	probably null
R5187:Myo5b	UTSW	18	74701674	missense	possibly damaging	0.68
R5232:Myo5b	UTSW	18	74714932	missense	probably damaging	0.99
R5254:Myo5b	UTSW	18	74700606	missense	possibly damaging	0.65
R5255:Myo5b	UTSW	18	74662670	missense	possibly damaging	0.94
R5715:Myo5b	UTSW	18	74742175	missense	possibly damaging	0.88
R5733:Myo5b	UTSW	18	74654057	missense	possibly damaging	0.93
R5797:Myo5b	UTSW	18	74701521	missense	probably benign
R5875:Myo5b	UTSW	18	74707902	splice site	probably null
R6088:Myo5b	UTSW	18	74720898	missense	possibly damaging	0.89
R6104:Myo5b	UTSW	18	74700679	missense	probably benign	0.19
R6237:Myo5b	UTSW	18	74742178	missense	probably damaging	1.00
R6265:Myo5b	UTSW	18	74577440	splice site	probably null
R6267:Myo5b	UTSW	18	74616991	missense	probably damaging	1.00
R6328:Myo5b	UTSW	18	74616993	missense	probably damaging	1.00
R6330:Myo5b	UTSW	18	74616993	missense	probably damaging	1.00
R6331:Myo5b	UTSW	18	74616993	missense	probably damaging	1.00
R6347:Myo5b	UTSW	18	74770385	missense	probably benign	0.11
R6479:Myo5b	UTSW	18	74617015	missense	probably damaging	1.00
R6748:Myo5b	UTSW	18	74701503	missense	possibly damaging	0.80
R6749:Myo5b	UTSW	18	74701503	missense	possibly damaging	0.80
R6750:Myo5b	UTSW	18	74617035	missense	possibly damaging	0.74
R6833:Myo5b	UTSW	18	74770325	missense	probably benign
R6876:Myo5b	UTSW	18	74707955	missense	probably benign
R6880:Myo5b	UTSW	18	74722430	missense	probably benign	0.02
R6902:Myo5b	UTSW	18	74676685	missense	possibly damaging	0.95
R6985:Myo5b	UTSW	18	74653361	missense	possibly damaging	0.93
R7039:Myo5b	UTSW	18	74701528	missense	probably benign	0.01
R7162:Myo5b	UTSW	18	74695427	missense	probably benign	0.02
R7345:Myo5b	UTSW	18	74708024	missense	possibly damaging	0.82
R7530:Myo5b	UTSW	18	74731731	missense	probably benign	0.00
R7564:Myo5b	UTSW	18	74634511	missense	possibly damaging	0.84
R7629:Myo5b	UTSW	18	74627254	critical splice donor site	probably null
R7635:Myo5b	UTSW	18	74580396	missense	probably damaging	1.00
R7670:Myo5b	UTSW	18	74701446	missense	probably benign	0.05
R7754:Myo5b	UTSW	18	74634559	missense	probably benign	0.02
R7930:Myo5b	UTSW	18	74731754	missense	probably benign
R8013:Myo5b	UTSW	18	74760899	nonsense	probably null
R8271:Myo5b	UTSW	18	74627190	missense	probably damaging	1.00
R8312:Myo5b	UTSW	18	74733962	missense	probably damaging	1.00
R8383:Myo5b	UTSW	18	74643978	missense	probably benign	0.05
R8384:Myo5b	UTSW	18	74742202	missense	probably damaging	1.00
R8474:Myo5b	UTSW	18	74770340	missense	probably damaging	1.00
R8825:Myo5b	UTSW	18	74759098	missense	possibly damaging	0.79
R8846:Myo5b	UTSW	18	74707972	missense	probably benign	0.04
R9236:Myo5b	UTSW	18	74720863	missense	probably benign
R9283:Myo5b	UTSW	18	74644078	missense	probably benign	0.16
R9370:Myo5b	UTSW	18	74627175	missense	possibly damaging	0.54
R9506:Myo5b	UTSW	18	74744760	missense	possibly damaging	0.82
R9523:Myo5b	UTSW	18	74728897	missense	possibly damaging	0.89
R9622:Myo5b	UTSW	18	74714946	missense	probably damaging	0.99
R9676:Myo5b	UTSW	18	74759160	missense	probably benign	0.22
R9725:Myo5b	UTSW	18	74723770	missense	probably benign
RF009:Myo5b	UTSW	18	74643999	missense	probably damaging	1.00
Z1088:Myo5b	UTSW	18	74744749	missense	probably benign	0.35
Z1177:Myo5b	UTSW	18	74617017	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGTCCCTGCATATGTTGGCC -3'
(R):5'- ACCTGAGTTGCATGCCTGTG -3'

Sequencing Primer
(F):5'- CCCTGTGCATGTCTGAATGGC -3'
(R):5'- TCCAGGAGCAGGCGTCTTTC -3'

Posted On

2014-11-12