Incidental Mutation 'R2434:Fmo6'
ID250511
Institutional Source Beutler Lab
Gene Symbol Fmo6
Ensembl Gene ENSMUSG00000095576
Gene Nameflavin containing monooxygenase 6
Synonyms
MMRRC Submission 040395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2434 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162916551-162937515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 162916870 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 484 (N484K)
Ref Sequence ENSEMBL: ENSMUSP00000136378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178465] [ENSMUST00000195576]
Predicted Effect probably benign
Transcript: ENSMUST00000178465
AA Change: N484K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000136378
Gene: ENSMUSG00000095576
AA Change: N484K

DomainStartEndE-ValueType
Pfam:FMO-like 2 532 3.2e-273 PFAM
Pfam:Pyr_redox_2 3 226 2e-13 PFAM
Pfam:Pyr_redox_3 6 220 4.6e-17 PFAM
Pfam:K_oxygenase 79 223 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195576
SMART Domains Protein: ENSMUSP00000144106
Gene: ENSMUSG00000095576

DomainStartEndE-ValueType
Pfam:FMO-like 2 118 5.1e-58 PFAM
Pfam:NAD_binding_8 7 84 2.2e-5 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,013 Q493R probably damaging Het
Ank3 T C 10: 70,002,118 V785A probably damaging Het
Capsl A T 15: 9,462,709 H145L probably damaging Het
Carns1 A C 19: 4,165,449 C911W probably damaging Het
Celsr2 A C 3: 108,404,479 F1351V probably damaging Het
Cpne8 T C 15: 90,509,511 I432V probably benign Het
Cpxm1 A T 2: 130,394,084 I386N probably damaging Het
E2f5 T A 3: 14,579,014 D65E probably damaging Het
Eif3a T C 19: 60,764,050 probably benign Het
Fcrls A G 3: 87,256,698 Y375H probably damaging Het
Fip1l1 C A 5: 74,546,824 T196K possibly damaging Het
Foxred1 G T 9: 35,205,658 D345E probably damaging Het
Gbe1 T A 16: 70,441,212 N295K probably damaging Het
Gipc2 T A 3: 152,137,680 I107L probably benign Het
Gm9268 A G 7: 43,047,457 Y646C probably damaging Het
Kcnn1 GTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTC 8: 70,855,166 probably benign Het
Lgr5 T A 10: 115,587,406 I30L probably benign Het
Nbea A T 3: 55,647,460 V2589E possibly damaging Het
Ncam2 A T 16: 81,595,225 N699I probably benign Het
Nlrp1b T C 11: 71,156,726 probably null Het
Olfr323 A G 11: 58,625,111 Y312H possibly damaging Het
Rnasel T C 1: 153,754,650 V304A probably damaging Het
Serinc4 C T 2: 121,455,705 R134H probably benign Het
Sim1 T A 10: 50,907,958 Y103N probably damaging Het
Slc47a1 A T 11: 61,367,722 probably null Het
Slc6a6 T A 6: 91,735,212 S241T probably benign Het
Son G T 16: 91,654,687 K107N probably damaging Het
St3gal6 T C 16: 58,470,652 T329A probably damaging Het
Stab2 G A 10: 86,969,319 P265L possibly damaging Het
Tmem199 G A 11: 78,509,744 T119I probably damaging Het
Ttc14 A G 3: 33,801,078 D125G probably benign Het
Vmn1r205 T A 13: 22,592,354 M193L probably benign Het
Other mutations in Fmo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Fmo6 APN 1 162930011 nonsense probably null
IGL02083:Fmo6 APN 1 162920464 nonsense probably null
adventure UTSW 1 162922810 missense probably benign
R0792:Fmo6 UTSW 1 162920563 missense probably damaging 0.98
R0940:Fmo6 UTSW 1 162926226 missense probably benign 0.07
R1173:Fmo6 UTSW 1 162926141 missense probably damaging 1.00
R1268:Fmo6 UTSW 1 162920517 missense probably damaging 1.00
R1538:Fmo6 UTSW 1 162926106 missense probably damaging 1.00
R1694:Fmo6 UTSW 1 162922672 missense probably benign
R1717:Fmo6 UTSW 1 162926252 nonsense probably null
R1837:Fmo6 UTSW 1 162922810 missense probably benign
R2125:Fmo6 UTSW 1 162929958 missense possibly damaging 0.82
R2894:Fmo6 UTSW 1 162922724 nonsense probably null
R4864:Fmo6 UTSW 1 162924395 missense probably benign 0.34
R6414:Fmo6 UTSW 1 162920445 missense probably damaging 0.97
R6576:Fmo6 UTSW 1 162922695 missense probably damaging 1.00
R6883:Fmo6 UTSW 1 162929892 missense probably damaging 1.00
R7013:Fmo6 UTSW 1 162918248 missense probably benign 0.00
R7014:Fmo6 UTSW 1 162926308 missense probably benign 0.13
R7657:Fmo6 UTSW 1 162922716 missense probably benign
X0025:Fmo6 UTSW 1 162920496 missense probably benign 0.29
X0025:Fmo6 UTSW 1 162922858 missense probably damaging 1.00
Z1176:Fmo6 UTSW 1 162926132 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTCTAGGCTGGACTCTGG -3'
(R):5'- AACATTGGCAGACTGGGTGC -3'

Sequencing Primer
(F):5'- CTGGCACCCAGCAGACTTTG -3'
(R):5'- TCCTCAGGTTTGGCCAGAG -3'
Posted On2014-11-12