Incidental Mutation 'R2434:E2f5'
ID 250514
Institutional Source Beutler Lab
Gene Symbol E2f5
Ensembl Gene ENSMUSG00000027552
Gene Name E2F transcription factor 5
Synonyms E2F-5
MMRRC Submission 040395-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R2434 (G1)
Quality Score 180
Status Not validated
Chromosome 3
Chromosomal Location 14643701-14671369 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14644074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 65 (D65E)
Ref Sequence ENSEMBL: ENSMUSP00000029069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029069] [ENSMUST00000165922]
AlphaFold Q61502
Predicted Effect probably damaging
Transcript: ENSMUST00000029069
AA Change: D65E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029069
Gene: ENSMUSG00000027552
AA Change: D65E

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
Pfam:E2F_TDP 40 106 3.3e-28 PFAM
coiled coil region 111 146 N/A INTRINSIC
low complexity region 223 256 N/A INTRINSIC
low complexity region 283 293 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165922
AA Change: D65E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127877
Gene: ENSMUSG00000027552
AA Change: D65E

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
E2F_TDP 40 106 8.76e-31 SMART
Pfam:E2F_CC-MB 123 221 6.9e-35 PFAM
low complexity region 224 257 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop non-obstructive hydrocephalus, ruffled coats, ataxic gait, and dehydration after weaning and die prematurely at an average age of 6 weeks. They exhibit dilated ventricles and cerebral cortex atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 31,051,357 (GRCm39) Q493R probably damaging Het
Ank3 T C 10: 69,837,948 (GRCm39) V785A probably damaging Het
Capsl A T 15: 9,462,795 (GRCm39) H145L probably damaging Het
Carns1 A C 19: 4,215,448 (GRCm39) C911W probably damaging Het
Celsr2 A C 3: 108,311,795 (GRCm39) F1351V probably damaging Het
Cpne8 T C 15: 90,393,714 (GRCm39) I432V probably benign Het
Cpxm1 A T 2: 130,236,004 (GRCm39) I386N probably damaging Het
Eif3a T C 19: 60,752,488 (GRCm39) probably benign Het
Fcrl2 A G 3: 87,164,005 (GRCm39) Y375H probably damaging Het
Fip1l1 C A 5: 74,707,485 (GRCm39) T196K possibly damaging Het
Fmo6 A T 1: 162,744,439 (GRCm39) N484K probably benign Het
Foxred1 G T 9: 35,116,954 (GRCm39) D345E probably damaging Het
Gbe1 T A 16: 70,238,100 (GRCm39) N295K probably damaging Het
Gipc2 T A 3: 151,843,317 (GRCm39) I107L probably benign Het
Kcnn1 GTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTC 8: 71,307,810 (GRCm39) probably benign Het
Lgr5 T A 10: 115,423,311 (GRCm39) I30L probably benign Het
Nbea A T 3: 55,554,881 (GRCm39) V2589E possibly damaging Het
Ncam2 A T 16: 81,392,113 (GRCm39) N699I probably benign Het
Nlrp1b T C 11: 71,047,552 (GRCm39) probably null Het
Or11l3 A G 11: 58,515,937 (GRCm39) Y312H possibly damaging Het
Rnasel T C 1: 153,630,396 (GRCm39) V304A probably damaging Het
Serinc4 C T 2: 121,286,186 (GRCm39) R134H probably benign Het
Sim1 T A 10: 50,784,054 (GRCm39) Y103N probably damaging Het
Slc47a1 A T 11: 61,258,548 (GRCm39) probably null Het
Slc6a6 T A 6: 91,712,193 (GRCm39) S241T probably benign Het
Son G T 16: 91,451,575 (GRCm39) K107N probably damaging Het
St3gal6 T C 16: 58,291,015 (GRCm39) T329A probably damaging Het
Stab2 G A 10: 86,805,183 (GRCm39) P265L possibly damaging Het
Tmem199 G A 11: 78,400,570 (GRCm39) T119I probably damaging Het
Ttc14 A G 3: 33,855,227 (GRCm39) D125G probably benign Het
Vmn1r205 T A 13: 22,776,524 (GRCm39) M193L probably benign Het
Vmn2r-ps158 A G 7: 42,696,881 (GRCm39) Y646C probably damaging Het
Other mutations in E2f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:E2f5 APN 3 14,652,363 (GRCm39) splice site probably benign
IGL02388:E2f5 APN 3 14,653,340 (GRCm39) missense probably benign 0.00
IGL02415:E2f5 APN 3 14,668,957 (GRCm39) missense probably benign 0.00
R0401:E2f5 UTSW 3 14,644,085 (GRCm39) critical splice donor site probably null
R1977:E2f5 UTSW 3 14,652,416 (GRCm39) missense probably damaging 1.00
R3029:E2f5 UTSW 3 14,668,725 (GRCm39) missense probably benign 0.37
R4405:E2f5 UTSW 3 14,668,823 (GRCm39) missense probably benign 0.09
R4407:E2f5 UTSW 3 14,668,823 (GRCm39) missense probably benign 0.09
R4780:E2f5 UTSW 3 14,652,379 (GRCm39) missense probably benign 0.01
R6627:E2f5 UTSW 3 14,668,917 (GRCm39) missense probably benign 0.06
R9557:E2f5 UTSW 3 14,653,311 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCCATTTAAACTCGGGCCC -3'
(R):5'- CTTAAGCGAGTCCAGAGCAGAG -3'

Sequencing Primer
(F):5'- TGGCCGCTCGTGTGAATC -3'
(R):5'- AGAGCGCGAATTCCTGGG -3'
Posted On 2014-11-12