Incidental Mutation 'R2434:Agbl5'
ID 250520
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene Name ATP/GTP binding protein-like 5
Synonyms Ccp5, 9430057O19Rik
MMRRC Submission 040395-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2434 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 31046038-31064309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31051357 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 493 (Q493R)
Ref Sequence ENSEMBL: ENSMUSP00000144018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069705] [ENSMUST00000114700] [ENSMUST00000200695] [ENSMUST00000200850] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
AlphaFold Q09M02
Predicted Effect probably damaging
Transcript: ENSMUST00000069705
AA Change: Q493R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063228
Gene: ENSMUSG00000029165
AA Change: Q493R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 191 361 8.4e-19 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 4e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114700
AA Change: Q522R

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: Q522R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114704
AA Change: Q493R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110352
Gene: ENSMUSG00000029165
AA Change: Q493R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200695
SMART Domains Protein: ENSMUSP00000144109
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d2ctc__ 148 177 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200850
SMART Domains Protein: ENSMUSP00000144274
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200990
Predicted Effect probably benign
Transcript: ENSMUST00000201014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201167
Predicted Effect probably damaging
Transcript: ENSMUST00000201168
AA Change: Q493R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: Q493R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201225
AA Change: Q493R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165
AA Change: Q493R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201817
AA Change: Q493R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: Q493R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201917
AA Change: Q493R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: Q493R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201918
Predicted Effect probably damaging
Transcript: ENSMUST00000202060
AA Change: Q493R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165
AA Change: Q493R

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201901
Predicted Effect probably benign
Transcript: ENSMUST00000202109
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 T C 10: 69,837,948 (GRCm39) V785A probably damaging Het
Capsl A T 15: 9,462,795 (GRCm39) H145L probably damaging Het
Carns1 A C 19: 4,215,448 (GRCm39) C911W probably damaging Het
Celsr2 A C 3: 108,311,795 (GRCm39) F1351V probably damaging Het
Cpne8 T C 15: 90,393,714 (GRCm39) I432V probably benign Het
Cpxm1 A T 2: 130,236,004 (GRCm39) I386N probably damaging Het
E2f5 T A 3: 14,644,074 (GRCm39) D65E probably damaging Het
Eif3a T C 19: 60,752,488 (GRCm39) probably benign Het
Fcrl2 A G 3: 87,164,005 (GRCm39) Y375H probably damaging Het
Fip1l1 C A 5: 74,707,485 (GRCm39) T196K possibly damaging Het
Fmo6 A T 1: 162,744,439 (GRCm39) N484K probably benign Het
Foxred1 G T 9: 35,116,954 (GRCm39) D345E probably damaging Het
Gbe1 T A 16: 70,238,100 (GRCm39) N295K probably damaging Het
Gipc2 T A 3: 151,843,317 (GRCm39) I107L probably benign Het
Kcnn1 GTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTC 8: 71,307,810 (GRCm39) probably benign Het
Lgr5 T A 10: 115,423,311 (GRCm39) I30L probably benign Het
Nbea A T 3: 55,554,881 (GRCm39) V2589E possibly damaging Het
Ncam2 A T 16: 81,392,113 (GRCm39) N699I probably benign Het
Nlrp1b T C 11: 71,047,552 (GRCm39) probably null Het
Or11l3 A G 11: 58,515,937 (GRCm39) Y312H possibly damaging Het
Rnasel T C 1: 153,630,396 (GRCm39) V304A probably damaging Het
Serinc4 C T 2: 121,286,186 (GRCm39) R134H probably benign Het
Sim1 T A 10: 50,784,054 (GRCm39) Y103N probably damaging Het
Slc47a1 A T 11: 61,258,548 (GRCm39) probably null Het
Slc6a6 T A 6: 91,712,193 (GRCm39) S241T probably benign Het
Son G T 16: 91,451,575 (GRCm39) K107N probably damaging Het
St3gal6 T C 16: 58,291,015 (GRCm39) T329A probably damaging Het
Stab2 G A 10: 86,805,183 (GRCm39) P265L possibly damaging Het
Tmem199 G A 11: 78,400,570 (GRCm39) T119I probably damaging Het
Ttc14 A G 3: 33,855,227 (GRCm39) D125G probably benign Het
Vmn1r205 T A 13: 22,776,524 (GRCm39) M193L probably benign Het
Vmn2r-ps158 A G 7: 42,696,881 (GRCm39) Y646C probably damaging Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 31,050,578 (GRCm39) missense probably benign 0.00
sausage UTSW 5 31,051,702 (GRCm39) nonsense probably null
R0355:Agbl5 UTSW 5 31,049,335 (GRCm39) critical splice donor site probably null
R0575:Agbl5 UTSW 5 31,051,798 (GRCm39) missense probably damaging 1.00
R1694:Agbl5 UTSW 5 31,050,726 (GRCm39) missense probably damaging 1.00
R1709:Agbl5 UTSW 5 31,063,585 (GRCm39) missense probably damaging 1.00
R1829:Agbl5 UTSW 5 31,060,408 (GRCm39) missense possibly damaging 0.66
R3418:Agbl5 UTSW 5 31,062,067 (GRCm39) missense probably damaging 1.00
R4827:Agbl5 UTSW 5 31,053,158 (GRCm39) missense probably damaging 1.00
R4828:Agbl5 UTSW 5 31,048,059 (GRCm39) missense probably damaging 1.00
R4830:Agbl5 UTSW 5 31,048,059 (GRCm39) missense probably damaging 1.00
R5017:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5018:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5036:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5038:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5052:Agbl5 UTSW 5 31,048,558 (GRCm39) missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5073:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5074:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5081:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5083:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5103:Agbl5 UTSW 5 31,051,345 (GRCm39) missense probably damaging 1.00
R5107:Agbl5 UTSW 5 31,049,822 (GRCm39) missense probably damaging 1.00
R5130:Agbl5 UTSW 5 31,060,403 (GRCm39) missense probably damaging 1.00
R5395:Agbl5 UTSW 5 31,047,682 (GRCm39) missense probably damaging 1.00
R5522:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5524:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5526:Agbl5 UTSW 5 31,051,247 (GRCm39) splice site probably null
R5657:Agbl5 UTSW 5 31,051,390 (GRCm39) missense probably damaging 1.00
R5790:Agbl5 UTSW 5 31,051,702 (GRCm39) nonsense probably null
R6301:Agbl5 UTSW 5 31,049,177 (GRCm39) missense probably damaging 1.00
R6891:Agbl5 UTSW 5 31,052,522 (GRCm39) missense probably damaging 1.00
R6919:Agbl5 UTSW 5 31,062,061 (GRCm39) missense probably benign 0.13
R7388:Agbl5 UTSW 5 31,060,583 (GRCm39) nonsense probably null
R7392:Agbl5 UTSW 5 31,048,115 (GRCm39) critical splice donor site probably null
R7410:Agbl5 UTSW 5 31,048,032 (GRCm39) missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 31,050,735 (GRCm39) missense probably damaging 1.00
R8312:Agbl5 UTSW 5 31,051,850 (GRCm39) missense probably damaging 1.00
R8901:Agbl5 UTSW 5 31,048,435 (GRCm39) missense possibly damaging 0.58
RF007:Agbl5 UTSW 5 31,060,589 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTATGCGGGTGACATATGCG -3'
(R):5'- AACCTTGCTAACTGAGGCTC -3'

Sequencing Primer
(F):5'- TGACATATGCGGCAGAGTAACAC -3'
(R):5'- TGCTAACTGAGGCTCTCTTTTG -3'
Posted On 2014-11-12