Mutagenetix > Incidental Mutation

Incidental Mutation 'R0309:Ube3b'

25053

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

038519-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0309 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 114419469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

probably benign
Transcript: ENSMUST00000074002

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Coding Region Coverage

1x: 98.7%
3x: 97.6%
10x: 94.3%
20x: 86.4%

Validation Efficiency

98% (125/127)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 126 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	T	C	2: 35,376,259	D133G	possibly damaging	Het
Abcb4	A	C	5: 8,939,835	D796A	probably damaging	Het
Actg2	A	T	6: 83,519,914	V147E	probably damaging	Het
Adamts13	A	C	2: 26,986,989	T534P	probably damaging	Het
Ago1	T	C	4: 126,443,166	T249A	probably benign	Het
Ahnak	T	A	19: 9,002,495	I381N	probably damaging	Het
Akap9	A	G	5: 4,069,038	D3515G	probably benign	Het
Angptl3	T	C	4: 99,034,469	V249A	probably benign	Het
Ank	A	G	15: 27,567,572	T294A	possibly damaging	Het
Ank1	A	T	8: 23,104,809	H204L	probably damaging	Het
Apbb2	A	G	5: 66,310,988		probably benign	Het
Arhgap28	A	T	17: 67,901,429	S15T	probably benign	Het
Aspm	T	C	1: 139,482,511		probably benign	Het
Atp1a4	T	C	1: 172,234,987	E651G	probably damaging	Het
B3gnt2	A	T	11: 22,836,860	F109L	probably damaging	Het
Bpifb4	T	C	2: 153,959,683	F575L	probably damaging	Het
Calr	C	A	8: 84,843,031	K322N	probably benign	Het
Ccdc188	T	C	16: 18,219,305	S247P	possibly damaging	Het
Cdr1	T	A	X: 61,185,302	D86V	unknown	Het
Cep97	C	T	16: 55,925,058	V48I	probably damaging	Het
Chaf1b	T	A	16: 93,884,511	C6S	probably damaging	Het
Chd3	C	T	11: 69,357,018	D920N	probably damaging	Het
Clk1	T	C	1: 58,413,033		probably benign	Het
Cntnap3	T	A	13: 64,757,436		probably benign	Het
Col12a1	T	A	9: 79,600,011		probably null	Het
Col17a1	G	T	19: 47,671,362		probably benign	Het
Coq7	T	A	7: 118,529,717	I32F	possibly damaging	Het
Cox6a2	A	T	7: 128,205,935	F59I	probably damaging	Het
Cpq	A	G	15: 33,594,151	D436G	probably damaging	Het
Ctso	G	A	3: 81,944,861		probably null	Het
Cxadr	A	T	16: 78,334,948	H274L	probably benign	Het
Cyp2c40	A	T	19: 39,778,051	C367S	possibly damaging	Het
Cyp2c70	T	G	19: 40,160,671	M344L	possibly damaging	Het
Defa35	G	A	8: 21,065,855	V77I	probably benign	Het
Dhx57	A	G	17: 80,274,881	Y432H	probably damaging	Het
Dhx9	A	T	1: 153,465,695	D601E	probably benign	Het
Dnah7a	C	G	1: 53,405,690	D3952H	probably damaging	Het
Dnah9	C	A	11: 66,026,972		probably benign	Het
Dstyk	C	A	1: 132,456,864		probably benign	Het
Efcab2	T	A	1: 178,475,904		probably benign	Het
Ehbp1l1	T	C	19: 5,720,570	E287G	possibly damaging	Het
Epgn	A	G	5: 91,032,214	T87A	probably benign	Het
Erc2	A	C	14: 28,141,225	E803A	probably damaging	Het
Fam26d	A	G	10: 34,044,047	W75R	probably damaging	Het
Fer	A	G	17: 64,139,016	*454W	probably null	Het
Glyr1	T	C	16: 5,031,972	D179G	probably damaging	Het
Gm12830	T	A	4: 114,844,976		probably benign	Het
Gm14085	A	T	2: 122,517,553	T253S	probably benign	Het
Gm9922	C	A	14: 101,729,693		probably benign	Het
Gsta3	C	T	1: 21,264,894	P200S	possibly damaging	Het
Hmgxb3	G	A	18: 61,155,128		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Il16	T	C	7: 83,722,554	K15E	probably damaging	Het
Kcnip2	T	A	19: 45,794,075		probably benign	Het
Kdm4c	T	C	4: 74,345,567	V696A	probably benign	Het
Kdr	A	G	5: 75,946,927		probably benign	Het
Klhl33	T	G	14: 50,891,411	H787P	probably damaging	Het
Klk14	A	T	7: 43,694,345	T159S	probably benign	Het
Lancl2	A	G	6: 57,703,132	N16D	probably damaging	Het
Lemd3	T	C	10: 120,937,110	N583S	possibly damaging	Het
Map3k4	TGCTGGCTTCAGGGCCACAGTCCGCTG	TGCTG	17: 12,271,015		probably null	Het
Mpl	T	G	4: 118,446,038		probably benign	Het
Myh7b	T	C	2: 155,630,672		probably benign	Het
Mylk	A	C	16: 34,912,297		probably benign	Het
Myof	A	T	19: 37,981,266	M316K	probably benign	Het
Nfib	T	A	4: 82,296,737	N543I	probably damaging	Het
Nfix	A	G	8: 84,721,774	S375P	probably damaging	Het
Nkrf	T	C	X: 36,890,116	Q171R	probably damaging	Het
Nmnat2	T	A	1: 153,077,001		probably benign	Het
Npffr2	G	A	5: 89,583,347	E379K	probably benign	Het
Npr2	T	C	4: 43,640,904		probably benign	Het
Nup98	A	C	7: 102,152,428	D212E	probably null	Het
Nwd2	T	C	5: 63,807,218	Y1382H	probably damaging	Het
Ocstamp	T	C	2: 165,395,992	R451G	possibly damaging	Het
Olfr593	T	A	7: 103,212,721	I287K	probably damaging	Het
Olfr804	A	G	10: 129,705,139	D87G	probably benign	Het
Pabpc1	C	T	15: 36,597,493	A551T	possibly damaging	Het
Papd7	A	T	13: 69,499,932	V781E	possibly damaging	Het
Pard3	A	T	8: 127,376,897		probably benign	Het
Pcdhb12	G	T	18: 37,436,121	V107L	probably benign	Het
Pik3cd	A	T	4: 149,663,220	V22D	probably damaging	Het
Pkd1l2	A	G	8: 116,997,576	V2396A	probably damaging	Het
Pnpla7	T	C	2: 24,987,195	I167T	probably damaging	Het
Pphln1	A	T	15: 93,441,707	H114L	possibly damaging	Het
Ppm1h	A	G	10: 122,920,782	N444S	probably damaging	Het
Prdm9	G	A	17: 15,557,384	T146I	probably damaging	Het
Prrc2a	A	G	17: 35,150,915		probably benign	Het
Prrx1	T	C	1: 163,312,559	D26G	possibly damaging	Het
Ptpn5	T	C	7: 47,079,294	E495G	probably damaging	Het
Rab23	A	C	1: 33,734,861		probably null	Het
Ralgps1	C	T	2: 33,157,923	M348I	probably benign	Het
Ranbp2	A	G	10: 58,479,868	T2137A	probably benign	Het
Rapgef4	G	T	2: 72,226,030	G654V	probably benign	Het
Rc3h2	A	T	2: 37,379,008		probably benign	Het
Reg2	G	A	6: 78,406,186	A39T	possibly damaging	Het
Sema4d	C	A	13: 51,725,311	V7F	probably benign	Het
Sgip1	T	C	4: 102,915,157		probably benign	Het
Sgpl1	C	T	10: 61,113,437		probably null	Het
Shisa9	G	A	16: 11,997,123	V212M	probably damaging	Het
Shq1	G	A	6: 100,573,627	P450L	probably benign	Het
Sin3a	A	G	9: 57,110,912	T872A	probably benign	Het
Sipa1l3	C	T	7: 29,348,350	R1371Q	probably benign	Het
Skint8	T	C	4: 111,938,867	V246A	probably benign	Het
Slc22a20	A	T	19: 5,972,957	V386D	probably damaging	Het
Slc2a7	G	A	4: 150,158,071		probably benign	Het
Slc35a2	T	A	X: 7,889,662	Y48N	probably damaging	Het
Slc4a2	G	T	5: 24,434,346	S413I	probably damaging	Het
Sntg2	T	C	12: 30,226,773	T427A	probably benign	Het
Soat1	T	C	1: 156,442,453	Y132C	probably damaging	Het
Stn1	G	T	19: 47,501,673	H342N	probably benign	Het
Tarbp1	T	A	8: 126,438,928		probably benign	Het
Tas2r113	A	C	6: 132,893,378	K123T	probably damaging	Het
Tbck	C	T	3: 132,734,407	Q504*	probably null	Het
Tenm3	C	T	8: 48,341,034	C380Y	probably damaging	Het
Triobp	A	G	15: 78,976,540	D1389G	probably damaging	Het
Trpm4	A	T	7: 45,308,706	F780I	probably damaging	Het
Tubb4a	G	T	17: 57,081,182	Y281*	probably null	Het
Txndc15	T	C	13: 55,724,582	F261S	probably damaging	Het
Unc5c	G	C	3: 141,733,933	V196L	probably benign	Het
Upf3a	G	A	8: 13,795,500		probably null	Het
Vmn2r20	T	C	6: 123,386,104	K574E	probably benign	Het
Vps50	A	G	6: 3,536,853	M275V	possibly damaging	Het
Xrcc5	A	G	1: 72,307,576		probably benign	Het
Zbtb18	T	C	1: 177,448,616	L505S	probably damaging	Het
Zbtb41	T	C	1: 139,438,984	I567T	probably damaging	Het
Zfp598	T	C	17: 24,678,584		probably benign	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- AGACACTAGATGGTCCTCCACTTCC -3'
(R):5'- GGCATAGCGTAGTTTCTCTCGCAG -3'

Sequencing Primer
(F):5'- GTCTTAGTTGACCTAGAACAGGACTC -3'
(R):5'- GTAGTTTCTCTCGCAGTACGC -3'

Posted On

2013-04-16