Incidental Mutation 'R2434:Olfr323'
ID250533
Institutional Source Beutler Lab
Gene Symbol Olfr323
Ensembl Gene ENSMUSG00000043880
Gene Nameolfactory receptor 323
SynonymsMOR107-1, GA_x6K02T2NKPP-794386-795357
MMRRC Submission 040395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2434 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58624159-58630501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58625111 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 312 (Y312H)
Ref Sequence ENSEMBL: ENSMUSP00000151137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070804] [ENSMUST00000203173] [ENSMUST00000214132]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070804
AA Change: Y312H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068147
Gene: ENSMUSG00000043880
AA Change: Y312H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-54 PFAM
Pfam:7tm_1 41 290 3.7e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000203173
AA Change: L125P
SMART Domains Protein: ENSMUSP00000145459
Gene: ENSMUSG00000043880
AA Change: L125P

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214132
AA Change: Y312H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,013 Q493R probably damaging Het
Ank3 T C 10: 70,002,118 V785A probably damaging Het
Capsl A T 15: 9,462,709 H145L probably damaging Het
Carns1 A C 19: 4,165,449 C911W probably damaging Het
Celsr2 A C 3: 108,404,479 F1351V probably damaging Het
Cpne8 T C 15: 90,509,511 I432V probably benign Het
Cpxm1 A T 2: 130,394,084 I386N probably damaging Het
E2f5 T A 3: 14,579,014 D65E probably damaging Het
Eif3a T C 19: 60,764,050 probably benign Het
Fcrls A G 3: 87,256,698 Y375H probably damaging Het
Fip1l1 C A 5: 74,546,824 T196K possibly damaging Het
Fmo6 A T 1: 162,916,870 N484K probably benign Het
Foxred1 G T 9: 35,205,658 D345E probably damaging Het
Gbe1 T A 16: 70,441,212 N295K probably damaging Het
Gipc2 T A 3: 152,137,680 I107L probably benign Het
Gm9268 A G 7: 43,047,457 Y646C probably damaging Het
Kcnn1 GTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTC 8: 70,855,166 probably benign Het
Lgr5 T A 10: 115,587,406 I30L probably benign Het
Nbea A T 3: 55,647,460 V2589E possibly damaging Het
Ncam2 A T 16: 81,595,225 N699I probably benign Het
Nlrp1b T C 11: 71,156,726 probably null Het
Rnasel T C 1: 153,754,650 V304A probably damaging Het
Serinc4 C T 2: 121,455,705 R134H probably benign Het
Sim1 T A 10: 50,907,958 Y103N probably damaging Het
Slc47a1 A T 11: 61,367,722 probably null Het
Slc6a6 T A 6: 91,735,212 S241T probably benign Het
Son G T 16: 91,654,687 K107N probably damaging Het
St3gal6 T C 16: 58,470,652 T329A probably damaging Het
Stab2 G A 10: 86,969,319 P265L possibly damaging Het
Tmem199 G A 11: 78,509,744 T119I probably damaging Het
Ttc14 A G 3: 33,801,078 D125G probably benign Het
Vmn1r205 T A 13: 22,592,354 M193L probably benign Het
Other mutations in Olfr323
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02995:Olfr323 APN 11 58625281 missense possibly damaging 0.92
IGL03118:Olfr323 APN 11 58625443 missense probably damaging 0.99
R0058:Olfr323 UTSW 11 58625668 missense probably damaging 1.00
R0335:Olfr323 UTSW 11 58625740 missense probably damaging 1.00
R1127:Olfr323 UTSW 11 58625458 missense probably damaging 0.98
R2029:Olfr323 UTSW 11 58625493 missense probably damaging 1.00
R5483:Olfr323 UTSW 11 58625957 missense possibly damaging 0.95
R6423:Olfr323 UTSW 11 58625363 missense probably damaging 1.00
R6990:Olfr323 UTSW 11 58625458 missense probably damaging 0.98
R7472:Olfr323 UTSW 11 58625434 missense probably damaging 1.00
R7539:Olfr323 UTSW 11 58625956 missense probably damaging 1.00
R7635:Olfr323 UTSW 11 58625164 missense unknown
R7647:Olfr323 UTSW 11 58625203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGGCACTTCAGACTTATC -3'
(R):5'- GCTGTGGTCACCATCTACTAC -3'

Sequencing Primer
(F):5'- GAGGGCACTTCAGACTTATCTTTTTC -3'
(R):5'- TGGTCACCATCTACTACGGGAC -3'
Posted On2014-11-12