Incidental Mutation 'R2434:Carns1'
ID250542
Institutional Source Beutler Lab
Gene Symbol Carns1
Ensembl Gene ENSMUSG00000075289
Gene Namecarnosine synthase 1
SynonymsAtpgd1
MMRRC Submission 040395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2434 (G1)
Quality Score149
Status Not validated
Chromosome19
Chromosomal Location4164324-4175479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 4165449 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 911 (C911W)
Ref Sequence ENSEMBL: ENSMUSP00000131624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025749] [ENSMUST00000118483] [ENSMUST00000127605] [ENSMUST00000130469] [ENSMUST00000137431] [ENSMUST00000167055]
Predicted Effect probably benign
Transcript: ENSMUST00000025749
SMART Domains Protein: ENSMUSP00000025749
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 391 2.6e-26 SMART
low complexity region 406 421 N/A INTRINSIC
low complexity region 428 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118483
SMART Domains Protein: ENSMUSP00000112512
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 384 1.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125057
Predicted Effect probably benign
Transcript: ENSMUST00000127605
SMART Domains Protein: ENSMUSP00000123376
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 304 1.6e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130469
SMART Domains Protein: ENSMUSP00000117446
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase 67 153 2.7e-14 PFAM
Pfam:Pkinase_Tyr 67 153 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135911
Predicted Effect probably benign
Transcript: ENSMUST00000137431
SMART Domains Protein: ENSMUSP00000116744
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase_Tyr 67 277 4.6e-31 PFAM
Pfam:Pkinase 67 278 2.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155303
Predicted Effect probably damaging
Transcript: ENSMUST00000167055
AA Change: C911W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131624
Gene: ENSMUSG00000075289
AA Change: C911W

DomainStartEndE-ValueType
low complexity region 206 217 N/A INTRINSIC
low complexity region 312 328 N/A INTRINSIC
low complexity region 332 348 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 414 433 N/A INTRINSIC
low complexity region 490 496 N/A INTRINSIC
Pfam:ATP-grasp_4 620 819 4.1e-46 PFAM
low complexity region 862 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181211
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CARNS1 (EC 6.3.2.11), a member of the ATP-grasp family of ATPases, catalyzes the formation of carnosine (beta-alanyl-L-histidine) and homocarnosine (gamma-aminobutyryl-L-histidine), which are found mainly in skeletal muscle and the central nervous system, respectively (Drozak et al., 2010 [PubMed 20097752]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,013 Q493R probably damaging Het
Ank3 T C 10: 70,002,118 V785A probably damaging Het
Capsl A T 15: 9,462,709 H145L probably damaging Het
Celsr2 A C 3: 108,404,479 F1351V probably damaging Het
Cpne8 T C 15: 90,509,511 I432V probably benign Het
Cpxm1 A T 2: 130,394,084 I386N probably damaging Het
E2f5 T A 3: 14,579,014 D65E probably damaging Het
Eif3a T C 19: 60,764,050 probably benign Het
Fcrls A G 3: 87,256,698 Y375H probably damaging Het
Fip1l1 C A 5: 74,546,824 T196K possibly damaging Het
Fmo6 A T 1: 162,916,870 N484K probably benign Het
Foxred1 G T 9: 35,205,658 D345E probably damaging Het
Gbe1 T A 16: 70,441,212 N295K probably damaging Het
Gipc2 T A 3: 152,137,680 I107L probably benign Het
Gm9268 A G 7: 43,047,457 Y646C probably damaging Het
Kcnn1 GTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTC 8: 70,855,166 probably benign Het
Lgr5 T A 10: 115,587,406 I30L probably benign Het
Nbea A T 3: 55,647,460 V2589E possibly damaging Het
Ncam2 A T 16: 81,595,225 N699I probably benign Het
Nlrp1b T C 11: 71,156,726 probably null Het
Olfr323 A G 11: 58,625,111 Y312H possibly damaging Het
Rnasel T C 1: 153,754,650 V304A probably damaging Het
Serinc4 C T 2: 121,455,705 R134H probably benign Het
Sim1 T A 10: 50,907,958 Y103N probably damaging Het
Slc47a1 A T 11: 61,367,722 probably null Het
Slc6a6 T A 6: 91,735,212 S241T probably benign Het
Son G T 16: 91,654,687 K107N probably damaging Het
St3gal6 T C 16: 58,470,652 T329A probably damaging Het
Stab2 G A 10: 86,969,319 P265L possibly damaging Het
Tmem199 G A 11: 78,509,744 T119I probably damaging Het
Ttc14 A G 3: 33,801,078 D125G probably benign Het
Vmn1r205 T A 13: 22,592,354 M193L probably benign Het
Other mutations in Carns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Carns1 APN 19 4166499 splice site probably null
IGL02246:Carns1 APN 19 4166432 missense possibly damaging 0.87
IGL02658:Carns1 APN 19 4173084 missense probably benign 0.01
IGL02800:Carns1 APN 19 4166570 splice site probably benign
R1750:Carns1 UTSW 19 4173157 missense possibly damaging 0.63
R1902:Carns1 UTSW 19 4166338 missense probably damaging 1.00
R1935:Carns1 UTSW 19 4165474 missense probably damaging 1.00
R2437:Carns1 UTSW 19 4165783 missense possibly damaging 0.69
R3772:Carns1 UTSW 19 4170916 splice site probably benign
R4091:Carns1 UTSW 19 4171683 missense probably damaging 0.96
R4518:Carns1 UTSW 19 4170070 missense probably benign 0.05
R4668:Carns1 UTSW 19 4165476 nonsense probably null
R4737:Carns1 UTSW 19 4170928 intron probably benign
R4751:Carns1 UTSW 19 4166418 missense probably damaging 1.00
R5384:Carns1 UTSW 19 4171901 critical splice acceptor site probably null
R6077:Carns1 UTSW 19 4170876 missense probably benign 0.01
R6373:Carns1 UTSW 19 4166516 missense probably benign 0.41
R6411:Carns1 UTSW 19 4166464 missense probably damaging 1.00
R6470:Carns1 UTSW 19 4171783 missense possibly damaging 0.85
R6486:Carns1 UTSW 19 4169980 missense probably benign 0.04
R6915:Carns1 UTSW 19 4169913 missense probably benign 0.34
R6981:Carns1 UTSW 19 4170082 missense probably benign 0.00
R7936:Carns1 UTSW 19 4166153 missense probably benign
R8025:Carns1 UTSW 19 4166506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGGTAGCATGCTGACCC -3'
(R):5'- TGGCTACCTAGTGGGCATCATG -3'

Sequencing Primer
(F):5'- AGCATGCTGACCCTGGGTTG -3'
(R):5'- ATCATGTGCCTGGTGTCCC -3'
Posted On2014-11-12