Incidental Mutation 'R2445:Zgpat'
ID250546
Institutional Source Beutler Lab
Gene Symbol Zgpat
Ensembl Gene ENSMUSG00000027582
Gene Namezinc finger, CCCH-type with G patch domain
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2445 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181364928-181383628 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 181366160 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 163 (C163*)
Ref Sequence ENSEMBL: ENSMUSP00000112067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029105] [ENSMUST00000108807] [ENSMUST00000108808] [ENSMUST00000116366] [ENSMUST00000127988] [ENSMUST00000170190] [ENSMUST00000183499] [ENSMUST00000185118]
Predicted Effect probably null
Transcript: ENSMUST00000029105
AA Change: C163*
SMART Domains Protein: ENSMUSP00000029105
Gene: ENSMUSG00000027582
AA Change: C163*

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048269
Predicted Effect probably null
Transcript: ENSMUST00000108807
AA Change: C163*
SMART Domains Protein: ENSMUSP00000104435
Gene: ENSMUSG00000027582
AA Change: C163*

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108808
SMART Domains Protein: ENSMUSP00000104436
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000116366
AA Change: C163*
SMART Domains Protein: ENSMUSP00000112067
Gene: ENSMUSG00000027582
AA Change: C163*

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127988
SMART Domains Protein: ENSMUSP00000122066
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152580
Predicted Effect probably benign
Transcript: ENSMUST00000170190
SMART Domains Protein: ENSMUSP00000126387
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Miro 1 90 1.2e-9 PFAM
Pfam:Arf 1 140 8.5e-38 PFAM
Pfam:Gtr1_RagA 2 110 2.2e-6 PFAM
Pfam:SRPRB 4 118 6e-8 PFAM
Pfam:Ras 4 142 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183499
SMART Domains Protein: ENSMUSP00000138941
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 61 4.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184859
Predicted Effect probably benign
Transcript: ENSMUST00000185118
SMART Domains Protein: ENSMUSP00000139211
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 120 1.6e-30 PFAM
Pfam:SRPRB 15 116 6.6e-8 PFAM
Pfam:Ras 19 116 2.1e-9 PFAM
Pfam:Miro 19 117 7.3e-12 PFAM
Pfam:MMR_HSR1 19 117 1.2e-7 PFAM
Pfam:Gtr1_RagA 19 119 5.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930562C15Rik T A 16: 4,864,397 probably null Het
Akr1b3 G T 6: 34,310,934 D163E probably benign Het
D130043K22Rik A G 13: 24,857,036 D147G probably benign Het
F5 T C 1: 164,190,226 F624S probably damaging Het
Gpr182 T C 10: 127,750,627 T152A probably benign Het
Ifna13 A T 4: 88,643,896 W164R probably damaging Het
Lsg1 C A 16: 30,564,695 R569L probably benign Het
Mmp27 T C 9: 7,581,181 S456P probably benign Het
Naip6 A G 13: 100,300,668 V449A probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1130 T C 2: 87,607,958 I190T probably damaging Het
Ptpn23 G T 9: 110,387,632 P1052Q possibly damaging Het
Sacs A G 14: 61,205,206 H1567R probably damaging Het
Slc30a7 A T 3: 115,978,653 I280K probably damaging Het
Slc6a18 A T 13: 73,666,752 C15* probably null Het
Tnrc18 T A 5: 142,772,115 I884F unknown Het
Trav6d-3 G A 14: 52,726,828 A83T probably damaging Het
Other mutations in Zgpat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Zgpat APN 2 181378889 missense probably benign 0.02
IGL02221:Zgpat APN 2 181378858 missense probably benign 0.41
IGL02507:Zgpat APN 2 181366236 missense probably damaging 1.00
IGL03124:Zgpat APN 2 181366180 missense probably benign 0.05
R0559:Zgpat UTSW 2 181380192 splice site probably benign
R1451:Zgpat UTSW 2 181380191 splice site probably benign
R1541:Zgpat UTSW 2 181378865 missense probably benign 0.01
R1758:Zgpat UTSW 2 181378840 missense probably damaging 1.00
R3038:Zgpat UTSW 2 181366018 unclassified probably benign
R3700:Zgpat UTSW 2 181365646 unclassified probably benign
R4888:Zgpat UTSW 2 181378858 missense probably benign 0.41
R5594:Zgpat UTSW 2 181365627 unclassified probably benign
R6890:Zgpat UTSW 2 181378511 missense probably damaging 0.98
R7023:Zgpat UTSW 2 181366018 unclassified probably benign
R7350:Zgpat UTSW 2 181380435 missense
R7396:Zgpat UTSW 2 181366089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCAGAAGGCCATTGCG -3'
(R):5'- AAACTAGTTGTGGCGACAGG -3'

Sequencing Primer
(F):5'- CCTGCAATGACTCGGAGAC -3'
(R):5'- GACAGGCCACAGCGGTG -3'
Posted On2014-11-12