Incidental Mutation 'R2445:Slc30a7'
ID 250547
Institutional Source Beutler Lab
Gene Symbol Slc30a7
Ensembl Gene ENSMUSG00000054414
Gene Name solute carrier family 30 (zinc transporter), member 7
Synonyms 2610034N15Rik, 4833428C12Rik, 1810059J10Rik, ZnT-7, ZnT7
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock # R2445 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 115938973-116007406 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115978653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 280 (I280K)
Ref Sequence ENSEMBL: ENSMUSP00000065254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067485]
AlphaFold Q9JKN1
Predicted Effect probably damaging
Transcript: ENSMUST00000067485
AA Change: I280K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065254
Gene: ENSMUSG00000054414
AA Change: I280K

DomainStartEndE-ValueType
Pfam:Cation_efflux 38 296 3.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158636
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc functions as a cofactor for numerous enzymes, nuclear factors, and hormones and as an intra- and intercellular signal ion. Members of the zinc transporter (ZNT)/SLC30 subfamily of the cation diffusion facilitator family, such as SLC30A7, permit cellular efflux of zinc (Seve et al., 2004 [PubMed 15154973]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a low body zinc status, reduced food intake and poor body weight gain, and are lean due to a significant reduction in body fat accumulation; however, no signs of hair growth abnormalities or dermatitis are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930562C15Rik T A 16: 4,864,397 probably null Het
Akr1b3 G T 6: 34,310,934 D163E probably benign Het
D130043K22Rik A G 13: 24,857,036 D147G probably benign Het
F5 T C 1: 164,190,226 F624S probably damaging Het
Gpr182 T C 10: 127,750,627 T152A probably benign Het
Ifna13 A T 4: 88,643,896 W164R probably damaging Het
Lsg1 C A 16: 30,564,695 R569L probably benign Het
Mmp27 T C 9: 7,581,181 S456P probably benign Het
Naip6 A G 13: 100,300,668 V449A probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1130 T C 2: 87,607,958 I190T probably damaging Het
Ptpn23 G T 9: 110,387,632 P1052Q possibly damaging Het
Sacs A G 14: 61,205,206 H1567R probably damaging Het
Slc6a18 A T 13: 73,666,752 C15* probably null Het
Tnrc18 T A 5: 142,772,115 I884F unknown Het
Trav6d-3 G A 14: 52,726,828 A83T probably damaging Het
Zgpat C A 2: 181,366,160 C163* probably null Het
Other mutations in Slc30a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Slc30a7 APN 3 115946720 splice site probably null
IGL01161:Slc30a7 APN 3 115954110 missense possibly damaging 0.54
IGL01360:Slc30a7 APN 3 115990116 missense probably damaging 1.00
IGL02573:Slc30a7 APN 3 115990147 splice site probably benign
R0833:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R0836:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R1381:Slc30a7 UTSW 3 115956870 critical splice donor site probably null
R4072:Slc30a7 UTSW 3 115946680 missense probably damaging 0.96
R4850:Slc30a7 UTSW 3 115993008 missense probably damaging 0.99
R5429:Slc30a7 UTSW 3 116006925 missense possibly damaging 0.90
R5586:Slc30a7 UTSW 3 115990051 missense probably benign 0.36
R6170:Slc30a7 UTSW 3 115990743 missense probably damaging 1.00
R6813:Slc30a7 UTSW 3 115981811 missense probably benign 0.01
R6889:Slc30a7 UTSW 3 115954153 missense probably damaging 1.00
R8445:Slc30a7 UTSW 3 116007346 unclassified probably benign
R8872:Slc30a7 UTSW 3 115946668 missense possibly damaging 0.69
X0023:Slc30a7 UTSW 3 115990025 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGGTTTGACATTGTCAGTTC -3'
(R):5'- AGTCCTGAGAAATATTCCCACTTG -3'

Sequencing Primer
(F):5'- CGTCTAGTTAATGACTTTACATTGCC -3'
(R):5'- TGAGAAATATTCCCACTTGAGTATTC -3'
Posted On 2014-11-12