Incidental Mutation 'R2445:Akr1b1'
ID 250550
Institutional Source Beutler Lab
Gene Symbol Akr1b1
Ensembl Gene ENSMUSG00000001642
Gene Name aldo-keto reductase family 1 member B
Synonyms Aldr1, Ahr1, AR, Ahr-1, Akr1b3, ALR2, Aldor1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R2445 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 34280865-34294424 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 34287869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 163 (D163E)
Ref Sequence ENSEMBL: ENSMUSP00000114391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102980] [ENSMUST00000154655]
AlphaFold P45376
Predicted Effect probably benign
Transcript: ENSMUST00000102980
AA Change: D140E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000100045
Gene: ENSMUSG00000001642
AA Change: D140E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 13 294 4.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142761
Predicted Effect probably benign
Transcript: ENSMUST00000154655
AA Change: D163E

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114391
Gene: ENSMUSG00000001642
AA Change: D163E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 176 9.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201392
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased drinking, increased urination, and dilation of the renal tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
4930562C15Rik T A 16: 4,682,261 (GRCm39) probably null Het
D130043K22Rik A G 13: 25,041,019 (GRCm39) D147G probably benign Het
F5 T C 1: 164,017,795 (GRCm39) F624S probably damaging Het
Gpr182 T C 10: 127,586,496 (GRCm39) T152A probably benign Het
Ifna13 A T 4: 88,562,133 (GRCm39) W164R probably damaging Het
Lsg1 C A 16: 30,383,513 (GRCm39) R569L probably benign Het
Mmp27 T C 9: 7,581,182 (GRCm39) S456P probably benign Het
Naip6 A G 13: 100,437,176 (GRCm39) V449A probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or10ag60 T C 2: 87,438,302 (GRCm39) I190T probably damaging Het
Ptpn23 G T 9: 110,216,700 (GRCm39) P1052Q possibly damaging Het
Sacs A G 14: 61,442,655 (GRCm39) H1567R probably damaging Het
Slc30a7 A T 3: 115,772,302 (GRCm39) I280K probably damaging Het
Slc6a18 A T 13: 73,814,871 (GRCm39) C15* probably null Het
Tnrc18 T A 5: 142,757,870 (GRCm39) I884F unknown Het
Trav6d-3 G A 14: 52,964,285 (GRCm39) A83T probably damaging Het
Zgpat C A 2: 181,007,953 (GRCm39) C163* probably null Het
Other mutations in Akr1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Akr1b1 APN 6 34,281,254 (GRCm39) missense probably damaging 1.00
R0567:Akr1b1 UTSW 6 34,281,280 (GRCm39) splice site probably null
R0611:Akr1b1 UTSW 6 34,286,577 (GRCm39) missense probably benign 0.02
R1564:Akr1b1 UTSW 6 34,283,470 (GRCm39) splice site probably null
R2507:Akr1b1 UTSW 6 34,286,999 (GRCm39) missense probably damaging 1.00
R4323:Akr1b1 UTSW 6 34,287,862 (GRCm39) missense probably benign 0.00
R4373:Akr1b1 UTSW 6 34,281,202 (GRCm39) utr 3 prime probably benign
R4606:Akr1b1 UTSW 6 34,283,599 (GRCm39) unclassified probably benign
R5513:Akr1b1 UTSW 6 34,293,581 (GRCm39) intron probably benign
R6031:Akr1b1 UTSW 6 34,289,609 (GRCm39) missense probably benign 0.07
R6031:Akr1b1 UTSW 6 34,289,609 (GRCm39) missense probably benign 0.07
R6560:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6561:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6632:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6654:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6655:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6657:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6658:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6662:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R8209:Akr1b1 UTSW 6 34,288,867 (GRCm39) missense probably damaging 0.99
R8226:Akr1b1 UTSW 6 34,288,867 (GRCm39) missense probably damaging 0.99
R8921:Akr1b1 UTSW 6 34,289,639 (GRCm39) missense probably benign 0.00
R9802:Akr1b1 UTSW 6 34,283,508 (GRCm39) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGAAAACTGCCCTGGCGTTC -3'
(R):5'- CATGACGAGGATTCCCATCG -3'

Sequencing Primer
(F):5'- GCGTTCGTGAGACTTAACAGAC -3'
(R):5'- ATCTTGGCTACCACATATGCC -3'
Posted On 2014-11-12