Incidental Mutation 'R2445:Gpr182'
ID 250553
Institutional Source Beutler Lab
Gene Symbol Gpr182
Ensembl Gene ENSMUSG00000058396
Gene Name G protein-coupled receptor 182
Synonyms G10-D, NOW, Gpcr22, Admr, Gpcr17, AM-R
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2445 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 127747276-127751732 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127750627 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 152 (T152A)
Ref Sequence ENSEMBL: ENSMUSP00000100882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054287] [ENSMUST00000079692]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054287
SMART Domains Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617

DomainStartEndE-ValueType
BTB 30 126 9.15e-24 SMART
low complexity region 197 206 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 372 394 6.4e0 SMART
ZnF_C2H2 400 420 3.21e1 SMART
ZnF_C2H2 451 474 9.31e1 SMART
ZnF_C2H2 480 502 6.92e0 SMART
ZnF_C2H2 508 530 1.79e-2 SMART
ZnF_C2H2 538 560 1.18e-2 SMART
ZnF_C2H2 605 627 2.57e-3 SMART
ZnF_C2H2 633 655 3.78e-1 SMART
ZnF_C2H2 661 683 2.49e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079692
AA Change: T152A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000100882
Gene: ENSMUSG00000058396
AA Change: T152A

DomainStartEndE-ValueType
Pfam:7tm_1 66 316 1.2e-40 PFAM
low complexity region 340 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adrenomedullin is a potent vasodilator peptide that exerts major effects on cardiovascular function. This gene encodes a seven-transmembrane protein that belongs to the family 1 of G-protein coupled receptors. Studies of the rat counterpart suggest that the encoded protein may function as a receptor for adrenomedullin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930562C15Rik T A 16: 4,864,397 probably null Het
Akr1b3 G T 6: 34,310,934 D163E probably benign Het
D130043K22Rik A G 13: 24,857,036 D147G probably benign Het
F5 T C 1: 164,190,226 F624S probably damaging Het
Ifna13 A T 4: 88,643,896 W164R probably damaging Het
Lsg1 C A 16: 30,564,695 R569L probably benign Het
Mmp27 T C 9: 7,581,181 S456P probably benign Het
Naip6 A G 13: 100,300,668 V449A probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1130 T C 2: 87,607,958 I190T probably damaging Het
Ptpn23 G T 9: 110,387,632 P1052Q possibly damaging Het
Sacs A G 14: 61,205,206 H1567R probably damaging Het
Slc30a7 A T 3: 115,978,653 I280K probably damaging Het
Slc6a18 A T 13: 73,666,752 C15* probably null Het
Tnrc18 T A 5: 142,772,115 I884F unknown Het
Trav6d-3 G A 14: 52,726,828 A83T probably damaging Het
Zgpat C A 2: 181,366,160 C163* probably null Het
Other mutations in Gpr182
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Gpr182 APN 10 127750690 missense probably benign 0.09
IGL00983:Gpr182 APN 10 127750788 missense possibly damaging 0.89
IGL01337:Gpr182 APN 10 127750786 missense possibly damaging 0.95
IGL01810:Gpr182 APN 10 127750864 missense probably damaging 1.00
R0449:Gpr182 UTSW 10 127750696 missense probably damaging 1.00
R0554:Gpr182 UTSW 10 127751071 missense probably benign 0.00
R2229:Gpr182 UTSW 10 127750141 missense possibly damaging 0.91
R2292:Gpr182 UTSW 10 127750182 missense possibly damaging 0.89
R2349:Gpr182 UTSW 10 127750937 missense probably damaging 1.00
R5977:Gpr182 UTSW 10 127750879 missense possibly damaging 0.79
R6290:Gpr182 UTSW 10 127751024 missense probably benign 0.00
R6415:Gpr182 UTSW 10 127750506 missense possibly damaging 0.88
R8014:Gpr182 UTSW 10 127751005 missense possibly damaging 0.59
R8093:Gpr182 UTSW 10 127750914 missense probably damaging 1.00
R8333:Gpr182 UTSW 10 127749921 missense probably benign 0.08
R8543:Gpr182 UTSW 10 127750992 missense probably benign 0.43
R8788:Gpr182 UTSW 10 127750660 missense probably benign 0.00
R9047:Gpr182 UTSW 10 127750648 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTACGTTTCAAAAGGTGCTAG -3'
(R):5'- GATATGTGTCAACTGCCGCC -3'

Sequencing Primer
(F):5'- TACGTTTCAAAAGGTGCTAGGAAGAG -3'
(R):5'- GGGATGCTGAACCTGTACATC -3'
Posted On 2014-11-12