Mutagenetix > Incidental Mutations

Incidental Mutation 'R2445:D130043K22Rik'

250557

Institutional Source

Beutler Lab

Gene Symbol

D130043K22Rik

Ensembl Gene

ENSMUSG00000006711

Gene Name

RIKEN cDNA D130043K22 gene

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2445 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24845135-24901270 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24857036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 147 (D147G)

Ref Sequence

ENSEMBL: ENSMUSP00000006893 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]

AlphaFold

Q5SZV5

Predicted Effect

probably benign
Transcript: ENSMUST00000006893
AA Change: D147G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: D147G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Blast:MANEC	23	102	3e-44	BLAST
low complexity region	236	270	N/A	INTRINSIC
FN3	332	427	3.43e1	SMART
PKD	345	436	3.96e0	SMART
FN3	435	521	3.08e1	SMART
PKD	444	533	7.12e-10	SMART
PKD	539	629	1.46e-6	SMART
PKD	630	723	6.75e-11	SMART
FN3	634	711	5.1e1	SMART
FN3	728	808	9.15e1	SMART
PKD	729	820	4.38e-10	SMART
transmembrane domain	965	987	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141572
AA Change: D147G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711
AA Change: D147G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Blast:MANEC	23	102	2e-44	BLAST
low complexity region	236	270	N/A	INTRINSIC
FN3	332	427	3.43e1	SMART
PKD	345	436	3.96e0	SMART
FN3	435	521	3.08e1	SMART
PKD	444	533	7.12e-10	SMART
PKD	539	629	1.46e-6	SMART
PKD	630	723	6.75e-11	SMART
FN3	634	711	5.1e1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4930562C15Rik	T	A	16: 4,864,397		probably null	Het
Akr1b3	G	T	6: 34,310,934	D163E	probably benign	Het
F5	T	C	1: 164,190,226	F624S	probably damaging	Het
Gpr182	T	C	10: 127,750,627	T152A	probably benign	Het
Ifna13	A	T	4: 88,643,896	W164R	probably damaging	Het
Lsg1	C	A	16: 30,564,695	R569L	probably benign	Het
Mmp27	T	C	9: 7,581,181	S456P	probably benign	Het
Naip6	A	G	13: 100,300,668	V449A	probably damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1130	T	C	2: 87,607,958	I190T	probably damaging	Het
Ptpn23	G	T	9: 110,387,632	P1052Q	possibly damaging	Het
Sacs	A	G	14: 61,205,206	H1567R	probably damaging	Het
Slc30a7	A	T	3: 115,978,653	I280K	probably damaging	Het
Slc6a18	A	T	13: 73,666,752	C15*	probably null	Het
Tnrc18	T	A	5: 142,772,115	I884F	unknown	Het
Trav6d-3	G	A	14: 52,726,828	A83T	probably damaging	Het
Zgpat	C	A	2: 181,366,160	C163*	probably null	Het

Other mutations in D130043K22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:D130043K22Rik	APN	13	24867174	missense	probably damaging	1.00
IGL01114:D130043K22Rik	APN	13	24857156	missense	probably damaging	0.99
IGL01412:D130043K22Rik	APN	13	24887860	missense	probably damaging	1.00
IGL01542:D130043K22Rik	APN	13	24876037	splice site	probably null
IGL01615:D130043K22Rik	APN	13	24899796	missense	probably damaging	1.00
IGL01705:D130043K22Rik	APN	13	24857941	missense	probably benign	0.00
IGL02220:D130043K22Rik	APN	13	24883755	missense	possibly damaging	0.95
IGL02229:D130043K22Rik	APN	13	24875924	missense	probably damaging	1.00
IGL02576:D130043K22Rik	APN	13	24856870	missense	possibly damaging	0.74
IGL03038:D130043K22Rik	APN	13	24879619	missense	probably damaging	1.00
IGL03117:D130043K22Rik	APN	13	24889842	missense	probably damaging	1.00
IGL03014:D130043K22Rik	UTSW	13	24858092	missense	possibly damaging	0.88
R0019:D130043K22Rik	UTSW	13	24880812	missense	probably damaging	1.00
R0019:D130043K22Rik	UTSW	13	24880812	missense	probably damaging	1.00
R0020:D130043K22Rik	UTSW	13	24854492	utr 5 prime	probably benign
R0172:D130043K22Rik	UTSW	13	24872406	missense	probably benign	0.16
R0276:D130043K22Rik	UTSW	13	24858045	missense	possibly damaging	0.92
R0304:D130043K22Rik	UTSW	13	24864815	missense	probably benign	0.07
R0335:D130043K22Rik	UTSW	13	24887877	missense	probably damaging	0.98
R0744:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R0833:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R0836:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R1270:D130043K22Rik	UTSW	13	24857338	missense	probably benign	0.00
R1433:D130043K22Rik	UTSW	13	24871341	missense	probably damaging	1.00
R1682:D130043K22Rik	UTSW	13	24882556	missense	probably damaging	1.00
R1772:D130043K22Rik	UTSW	13	24875999	missense	probably damaging	1.00
R1773:D130043K22Rik	UTSW	13	24882602	missense	possibly damaging	0.80
R1800:D130043K22Rik	UTSW	13	24883894	missense	probably damaging	1.00
R1956:D130043K22Rik	UTSW	13	24885595	missense	probably damaging	1.00
R2255:D130043K22Rik	UTSW	13	24856911	missense	probably damaging	1.00
R2568:D130043K22Rik	UTSW	13	24883891	missense	probably damaging	0.97
R4160:D130043K22Rik	UTSW	13	24862696	missense	probably benign	0.02
R4494:D130043K22Rik	UTSW	13	24871356	missense	probably benign	0.16
R4732:D130043K22Rik	UTSW	13	24899665	missense	probably damaging	1.00
R4733:D130043K22Rik	UTSW	13	24899665	missense	probably damaging	1.00
R4782:D130043K22Rik	UTSW	13	24878040	missense	probably damaging	1.00
R4799:D130043K22Rik	UTSW	13	24878040	missense	probably damaging	1.00
R4864:D130043K22Rik	UTSW	13	24863612	missense	probably damaging	1.00
R5155:D130043K22Rik	UTSW	13	24872290	missense	probably damaging	1.00
R5240:D130043K22Rik	UTSW	13	24877977	missense	probably damaging	1.00
R5383:D130043K22Rik	UTSW	13	24857414	missense	probably benign	0.02
R5493:D130043K22Rik	UTSW	13	24863603	missense	probably damaging	1.00
R6184:D130043K22Rik	UTSW	13	24885591	missense	probably damaging	1.00
R6305:D130043K22Rik	UTSW	13	24885685	missense	probably damaging	1.00
R6436:D130043K22Rik	UTSW	13	24877935	missense	probably damaging	1.00
R6980:D130043K22Rik	UTSW	13	24864781	missense	probably damaging	0.98
R7038:D130043K22Rik	UTSW	13	24893408	missense	probably damaging	1.00
R7085:D130043K22Rik	UTSW	13	24872302	missense	possibly damaging	0.95
R7147:D130043K22Rik	UTSW	13	24882563	missense	probably benign	0.31
R7384:D130043K22Rik	UTSW	13	24882605	missense	probably damaging	1.00
R7398:D130043K22Rik	UTSW	13	24893377	missense	probably damaging	0.97
R7584:D130043K22Rik	UTSW	13	24872370	missense	probably damaging	1.00
R7585:D130043K22Rik	UTSW	13	24885585	missense	probably benign	0.01
R7588:D130043K22Rik	UTSW	13	24887893	missense	probably damaging	0.99
R7610:D130043K22Rik	UTSW	13	24876002	missense	probably benign	0.30
R7903:D130043K22Rik	UTSW	13	24876012	missense	probably damaging	0.98
R7966:D130043K22Rik	UTSW	13	24893423	missense	probably damaging	1.00
R8014:D130043K22Rik	UTSW	13	24856702	missense	probably damaging	1.00
R8374:D130043K22Rik	UTSW	13	24857979	missense	probably benign	0.07
R8543:D130043K22Rik	UTSW	13	24889869	missense	probably benign	0.08
R8775:D130043K22Rik	UTSW	13	24856999	nonsense	probably null
R8775-TAIL:D130043K22Rik	UTSW	13	24856999	nonsense	probably null
R8806:D130043K22Rik	UTSW	13	24899635	missense	probably benign	0.11
R8916:D130043K22Rik	UTSW	13	24872271	missense	probably benign
R9209:D130043K22Rik	UTSW	13	24857107	missense	possibly damaging	0.96
Z1177:D130043K22Rik	UTSW	13	24856709	missense	probably damaging	1.00
Z1177:D130043K22Rik	UTSW	13	24856834	missense	probably benign	0.39
Z1177:D130043K22Rik	UTSW	13	24872248	missense	possibly damaging	0.79
Z1177:D130043K22Rik	UTSW	13	24880847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCTATCTGGTGAAATGCATG -3'
(R):5'- TCTCCATGGAAGCAGCTGAG -3'

Sequencing Primer
(F):5'- CTATCTGGTGAAATGCATGCGCTC -3'
(R):5'- AAGCAGCTGAGTTGTCTCC -3'

Posted On

2014-11-12