Incidental Mutation 'R2445:D130043K22Rik'
ID 250557
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene Name RIKEN cDNA D130043K22 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2445 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 24845135-24901270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24857036 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 147 (D147G)
Ref Sequence ENSEMBL: ENSMUSP00000006893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
AlphaFold Q5SZV5
Predicted Effect probably benign
Transcript: ENSMUST00000006893
AA Change: D147G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: D147G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141572
AA Change: D147G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711
AA Change: D147G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930562C15Rik T A 16: 4,864,397 probably null Het
Akr1b3 G T 6: 34,310,934 D163E probably benign Het
F5 T C 1: 164,190,226 F624S probably damaging Het
Gpr182 T C 10: 127,750,627 T152A probably benign Het
Ifna13 A T 4: 88,643,896 W164R probably damaging Het
Lsg1 C A 16: 30,564,695 R569L probably benign Het
Mmp27 T C 9: 7,581,181 S456P probably benign Het
Naip6 A G 13: 100,300,668 V449A probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1130 T C 2: 87,607,958 I190T probably damaging Het
Ptpn23 G T 9: 110,387,632 P1052Q possibly damaging Het
Sacs A G 14: 61,205,206 H1567R probably damaging Het
Slc30a7 A T 3: 115,978,653 I280K probably damaging Het
Slc6a18 A T 13: 73,666,752 C15* probably null Het
Tnrc18 T A 5: 142,772,115 I884F unknown Het
Trav6d-3 G A 14: 52,726,828 A83T probably damaging Het
Zgpat C A 2: 181,366,160 C163* probably null Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7966:D130043K22Rik UTSW 13 24893423 missense probably damaging 1.00
R8014:D130043K22Rik UTSW 13 24856702 missense probably damaging 1.00
R8374:D130043K22Rik UTSW 13 24857979 missense probably benign 0.07
R8543:D130043K22Rik UTSW 13 24889869 missense probably benign 0.08
R8775:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8775-TAIL:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8806:D130043K22Rik UTSW 13 24899635 missense probably benign 0.11
R8916:D130043K22Rik UTSW 13 24872271 missense probably benign
R9209:D130043K22Rik UTSW 13 24857107 missense possibly damaging 0.96
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTATCTGGTGAAATGCATG -3'
(R):5'- TCTCCATGGAAGCAGCTGAG -3'

Sequencing Primer
(F):5'- CTATCTGGTGAAATGCATGCGCTC -3'
(R):5'- AAGCAGCTGAGTTGTCTCC -3'
Posted On 2014-11-12