Incidental Mutation 'R2446:Ibtk'
ID250571
Institutional Source Beutler Lab
Gene Symbol Ibtk
Ensembl Gene ENSMUSG00000035941
Gene Nameinhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms5430411K16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2446 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location85687360-85749334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85703073 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1173 (N1173D)
Ref Sequence ENSEMBL: ENSMUSP00000041145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039213] [ENSMUST00000187521]
Predicted Effect probably benign
Transcript: ENSMUST00000039213
AA Change: N1173D

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041145
Gene: ENSMUSG00000035941
AA Change: N1173D

DomainStartEndE-ValueType
ANK 51 80 2e0 SMART
ANK 85 114 2.58e-3 SMART
Pfam:RCC1 143 192 8.1e-10 PFAM
Pfam:RCC1 195 244 1.1e-14 PFAM
Pfam:RCC1 247 299 5.3e-13 PFAM
low complexity region 307 318 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
BTB 565 745 5.48e-13 SMART
BTB 769 872 4.09e-12 SMART
low complexity region 977 990 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186322
Predicted Effect probably benign
Transcript: ENSMUST00000187521
SMART Domains Protein: ENSMUSP00000139424
Gene: ENSMUSG00000035941

DomainStartEndE-ValueType
ANK 51 80 1.3e-2 SMART
ANK 85 114 1.7e-5 SMART
Pfam:RCC1 143 192 1.9e-8 PFAM
Pfam:RCC1 195 244 1.4e-12 PFAM
Pfam:RCC1 247 299 2.7e-10 PFAM
low complexity region 307 318 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bruton tyrosine kinase (BTK) is a protein tyrosine kinase that is expressed in B cells, macrophages, and neutrophils. The protein encoded by this gene binds to BTK and downregulates BTK's kinase activity. In addition, the encoded protein disrupts BTK-mediated calcium mobilization and negatively regulates the activation of nuclear factor-kappa-B-driven transcription. This gene has a pseudogene on chromosome 18. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more sustained calcium fluxes in spleen cells stimulated with IgM. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,031,648 I244T probably benign Het
Abca13 A G 11: 9,275,101 R527G probably benign Het
Cap1 T A 4: 122,864,608 I260F probably benign Het
Chst9 T C 18: 15,452,838 K223E possibly damaging Het
Dpy19l4 A T 4: 11,304,143 probably null Het
Ercc2 T C 7: 19,386,944 I223T probably damaging Het
Hydin T C 8: 110,587,715 L4277P possibly damaging Het
Klra17 T A 6: 129,831,514 H252L probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Npc1 A G 18: 12,214,339 V208A probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1461 T G 19: 13,165,447 C144W probably benign Het
P2rx7 A T 5: 122,680,816 M434L probably benign Het
Pcdhb9 G A 18: 37,403,287 G778E probably damaging Het
Scn7a A G 2: 66,692,658 Y901H probably damaging Het
Tlcd1 G A 11: 78,178,797 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r3 A G 3: 64,275,312 I322T probably damaging Het
Zbtb38 C T 9: 96,687,646 V462M probably damaging Het
Other mutations in Ibtk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ibtk APN 9 85717545 splice site probably null
IGL00852:Ibtk APN 9 85713601 missense probably benign 0.01
IGL00907:Ibtk APN 9 85690331 missense possibly damaging 0.51
IGL01101:Ibtk APN 9 85732622 splice site probably benign
IGL02125:Ibtk APN 9 85735070 missense probably damaging 1.00
IGL02214:Ibtk APN 9 85714179 splice site probably benign
IGL02223:Ibtk APN 9 85710366 splice site probably benign
IGL02638:Ibtk APN 9 85719893 missense probably damaging 1.00
IGL02741:Ibtk APN 9 85726612 missense probably damaging 1.00
IGL03299:Ibtk APN 9 85721136 missense probably benign 0.27
IGL03493:Ibtk APN 9 85718919 missense probably benign 0.44
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0558:Ibtk UTSW 9 85737538 missense probably damaging 0.99
R0569:Ibtk UTSW 9 85708181 splice site probably benign
R0932:Ibtk UTSW 9 85735046 missense probably damaging 1.00
R0973:Ibtk UTSW 9 85743577 missense probably damaging 1.00
R1237:Ibtk UTSW 9 85720748 missense probably benign 0.00
R1245:Ibtk UTSW 9 85720742 critical splice donor site probably null
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1921:Ibtk UTSW 9 85703082 missense probably benign
R2090:Ibtk UTSW 9 85720993 missense probably benign 0.01
R2109:Ibtk UTSW 9 85706550 missense probably benign
R2277:Ibtk UTSW 9 85703151 missense probably benign
R2437:Ibtk UTSW 9 85708125 missense probably benign 0.27
R3107:Ibtk UTSW 9 85710414 missense probably damaging 1.00
R3876:Ibtk UTSW 9 85718426 missense probably benign 0.06
R4160:Ibtk UTSW 9 85703090 missense probably benign 0.01
R4273:Ibtk UTSW 9 85726731 missense probably damaging 1.00
R4321:Ibtk UTSW 9 85735072 missense possibly damaging 0.49
R4827:Ibtk UTSW 9 85728554 missense probably benign 0.04
R4947:Ibtk UTSW 9 85710412 missense probably benign 0.00
R5228:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5268:Ibtk UTSW 9 85743690 missense probably benign 0.00
R5327:Ibtk UTSW 9 85737466 critical splice donor site probably null
R5344:Ibtk UTSW 9 85735004 missense possibly damaging 0.90
R5414:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5502:Ibtk UTSW 9 85720863 missense probably benign 0.13
R5756:Ibtk UTSW 9 85731254 missense possibly damaging 0.51
R7144:Ibtk UTSW 9 85743691 missense probably benign 0.03
R7196:Ibtk UTSW 9 85743656 missense probably damaging 1.00
R7490:Ibtk UTSW 9 85718934 critical splice acceptor site probably null
R7571:Ibtk UTSW 9 85722300 missense probably benign
X0021:Ibtk UTSW 9 85697174 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGGCTGTACTACACAAGTTCC -3'
(R):5'- CATGTTAGGGTAACTTGAAGCAGAG -3'

Sequencing Primer
(F):5'- TTCCAACATTTAAGTTTAAAGCCAAC -3'
(R):5'- CTTGAAGCAGAGATTAATTCTGAGTG -3'
Posted On2014-11-12