Incidental Mutation 'R2446:Npc1'
ID250579
Institutional Source Beutler Lab
Gene Symbol Npc1
Ensembl Gene ENSMUSG00000024413
Gene NameNPC intracellular cholesterol transporter 1
Synonymsnmf164, A430089E03Rik, D18Ertd723e, C85354, D18Ertd139e, lcsd
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R2446 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location12189693-12236400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12214339 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000025279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025279]
Predicted Effect probably benign
Transcript: ENSMUST00000025279
AA Change: V208A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413
AA Change: V208A

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149211
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for spontaneous and chemically induced mutations may exhibit lysosomal storage of non-esterified cholesterol, neurodegeneration, ataxia, presence of foam cells, sterility, and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,031,648 I244T probably benign Het
Abca13 A G 11: 9,275,101 R527G probably benign Het
Cap1 T A 4: 122,864,608 I260F probably benign Het
Chst9 T C 18: 15,452,838 K223E possibly damaging Het
Dpy19l4 A T 4: 11,304,143 probably null Het
Ercc2 T C 7: 19,386,944 I223T probably damaging Het
Hydin T C 8: 110,587,715 L4277P possibly damaging Het
Ibtk T C 9: 85,703,073 N1173D probably benign Het
Klra17 T A 6: 129,831,514 H252L probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1461 T G 19: 13,165,447 C144W probably benign Het
P2rx7 A T 5: 122,680,816 M434L probably benign Het
Pcdhb9 G A 18: 37,403,287 G778E probably damaging Het
Scn7a A G 2: 66,692,658 Y901H probably damaging Het
Tlcd1 G A 11: 78,178,797 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r3 A G 3: 64,275,312 I322T probably damaging Het
Zbtb38 C T 9: 96,687,646 V462M probably damaging Het
Other mutations in Npc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Npc1 APN 18 12199634 missense probably benign 0.45
IGL02523:Npc1 APN 18 12201572 missense probably benign 0.00
IGL03018:Npc1 APN 18 12214379 missense probably damaging 0.99
IGL03101:Npc1 APN 18 12198539 missense probably benign 0.15
IGL03151:Npc1 APN 18 12219275 missense probably benign 0.05
IGL03377:Npc1 APN 18 12211821 missense probably benign
PIT4354001:Npc1 UTSW 18 12211535 missense probably benign 0.00
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0190:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R0200:Npc1 UTSW 18 12219204 missense probably damaging 1.00
R0485:Npc1 UTSW 18 12213446 missense probably benign 0.00
R0699:Npc1 UTSW 18 12210575 missense probably benign 0.00
R0730:Npc1 UTSW 18 12219325 missense probably benign 0.00
R1302:Npc1 UTSW 18 12195085 missense probably benign 0.00
R1442:Npc1 UTSW 18 12195049 missense probably benign
R1463:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R1804:Npc1 UTSW 18 12223088 missense probably damaging 1.00
R1808:Npc1 UTSW 18 12194092 missense probably damaging 1.00
R1928:Npc1 UTSW 18 12213378 missense possibly damaging 0.79
R2112:Npc1 UTSW 18 12213472 missense possibly damaging 0.49
R2117:Npc1 UTSW 18 12196556 missense probably damaging 1.00
R2157:Npc1 UTSW 18 12191809 missense probably damaging 0.98
R2279:Npc1 UTSW 18 12197179 splice site probably null
R2311:Npc1 UTSW 18 12202183 missense probably benign
R3004:Npc1 UTSW 18 12197254 missense probably benign 0.03
R4090:Npc1 UTSW 18 12198162 splice site probably null
R4304:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4308:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4564:Npc1 UTSW 18 12191732 missense probably damaging 1.00
R4786:Npc1 UTSW 18 12199497 missense probably benign 0.35
R5243:Npc1 UTSW 18 12198631 intron probably benign
R5404:Npc1 UTSW 18 12213299 missense possibly damaging 0.79
R5823:Npc1 UTSW 18 12191789 missense possibly damaging 0.69
R6080:Npc1 UTSW 18 12219351 missense probably damaging 1.00
R6215:Npc1 UTSW 18 12236192 small deletion probably benign
R6301:Npc1 UTSW 18 12197245 missense probably benign 0.00
R6476:Npc1 UTSW 18 12201694 nonsense probably null
R7007:Npc1 UTSW 18 12210548 missense probably benign 0.02
R7020:Npc1 UTSW 18 12198537 missense probably damaging 1.00
R7048:Npc1 UTSW 18 12204765 splice site probably null
R7116:Npc1 UTSW 18 12211544 missense probably damaging 1.00
R7153:Npc1 UTSW 18 12213291 missense possibly damaging 0.78
R7359:Npc1 UTSW 18 12195180 missense probably benign 0.05
R7382:Npc1 UTSW 18 12201706 missense probably damaging 0.99
X0012:Npc1 UTSW 18 12193311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACCACAGTAGAAGTGTCTCAGC -3'
(R):5'- ATCTGGGCGGTGAGTTCAAG -3'

Sequencing Primer
(F):5'- CACAGTAGAAGTGTCTCAGCTTTTC -3'
(R):5'- GTGAGTTCAAGCCAGCATAACGTC -3'
Posted On2014-11-12