Incidental Mutation 'R1294:Dhh'
ID 250595
Institutional Source Beutler Lab
Gene Symbol Dhh
Ensembl Gene ENSMUSG00000023000
Gene Name desert hedgehog
Synonyms
MMRRC Submission 039360-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.752) question?
Stock # R1294 (G1)
Quality Score 75
Status Validated
Chromosome 15
Chromosomal Location 98789033-98796421 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98792264 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 248 (Q248R)
Ref Sequence ENSEMBL: ENSMUSP00000023737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023737] [ENSMUST00000229508] [ENSMUST00000229556] [ENSMUST00000229775]
AlphaFold Q61488
Predicted Effect probably benign
Transcript: ENSMUST00000023737
AA Change: Q248R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023737
Gene: ENSMUSG00000023000
AA Change: Q248R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HH_signal 23 185 2.1e-86 PFAM
Pfam:Peptidase_M15_3 129 185 5.9e-8 PFAM
HintN 197 304 1.29e-25 SMART
HintC 305 349 1.89e-9 SMART
low complexity region 358 374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229352
Predicted Effect probably benign
Transcript: ENSMUST00000229508
Predicted Effect probably benign
Transcript: ENSMUST00000229556
Predicted Effect probably benign
Transcript: ENSMUST00000229775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230242
Meta Mutation Damage Score 0.1417 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog family. The hedgehog gene family encodes signaling molecules that play an important role in regulating morphogenesis. This protein is predicted to be made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the organism. Defects in this protein have been associated with partial gonadal dysgenesis (PGD) accompanied by minifascicular polyneuropathy. This protein may be involved in both male gonadal differentiation and perineurial development. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mutants are male sterile, failing to produce mature spermatozoa; peripheral nerves are abnormal, with thin and disorganized perineurial sheaths. High penetrance of pseudohermaphroditism observed on some mixed backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C2cd2 A G 16: 97,723,469 (GRCm39) L16P probably damaging Het
Cfap57 A T 4: 118,463,731 (GRCm39) probably null Het
Cnn2 A G 10: 79,829,359 (GRCm39) D163G probably damaging Het
Csmd1 T C 8: 16,748,052 (GRCm39) D233G probably damaging Het
Csta2 T A 16: 36,077,618 (GRCm39) D58E probably damaging Het
Elavl2 G A 4: 91,199,826 (GRCm39) A19V probably benign Het
Fxr1 T A 3: 34,101,201 (GRCm39) M169K probably benign Het
Ghr A G 15: 3,418,128 (GRCm39) probably null Het
Gm5334 T C 7: 68,268,862 (GRCm39) S94P probably damaging Het
Klk1b3 C A 7: 43,849,720 (GRCm39) S35Y probably damaging Het
Lama5 T C 2: 179,832,714 (GRCm39) N1646S probably benign Het
Lap3 T C 5: 45,655,863 (GRCm39) V156A probably benign Het
Pcbp3 A G 10: 76,599,155 (GRCm39) I327T probably damaging Het
Plaat5 A G 19: 7,592,015 (GRCm39) probably benign Het
Polr1a A T 6: 71,889,886 (GRCm39) N35I probably damaging Het
Rab3c T C 13: 110,397,099 (GRCm39) T56A possibly damaging Het
Rapsn A T 2: 90,867,120 (GRCm39) K141* probably null Het
Rxrg G T 1: 167,441,470 (GRCm39) A83S probably benign Het
Serpinc1 T C 1: 160,817,211 (GRCm39) S102P probably damaging Het
Setd2 A G 9: 110,378,575 (GRCm39) N797D probably benign Het
Skic2 T C 17: 35,060,040 (GRCm39) probably null Het
Slc24a1 A T 9: 64,843,295 (GRCm39) V619E unknown Het
Slc25a20 A G 9: 108,554,838 (GRCm39) M128V probably benign Het
Spam1 A G 6: 24,796,906 (GRCm39) I286V probably benign Het
Tbc1d22a T A 15: 86,381,027 (GRCm39) F479Y probably damaging Het
Tdrd1 A G 19: 56,837,208 (GRCm39) probably null Het
Trim58 T A 11: 58,533,953 (GRCm39) I169N probably benign Het
Vmn1r25 A G 6: 57,955,464 (GRCm39) I275T possibly damaging Het
Zfp27 T A 7: 29,595,737 (GRCm39) Y76F possibly damaging Het
Other mutations in Dhh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Dhh APN 15 98,796,101 (GRCm39) unclassified probably benign
IGL01845:Dhh APN 15 98,795,864 (GRCm39) missense probably damaging 1.00
IGL02728:Dhh APN 15 98,792,192 (GRCm39) splice site probably null
R0096:Dhh UTSW 15 98,791,869 (GRCm39) missense probably benign 0.00
R1842:Dhh UTSW 15 98,792,441 (GRCm39) splice site probably null
R4351:Dhh UTSW 15 98,796,099 (GRCm39) unclassified probably benign
R4727:Dhh UTSW 15 98,796,023 (GRCm39) missense probably damaging 0.99
R4744:Dhh UTSW 15 98,792,139 (GRCm39) missense possibly damaging 0.86
R5120:Dhh UTSW 15 98,796,038 (GRCm39) missense probably benign 0.05
R6419:Dhh UTSW 15 98,792,282 (GRCm39) missense probably damaging 1.00
R6630:Dhh UTSW 15 98,792,247 (GRCm39) missense possibly damaging 0.86
R7031:Dhh UTSW 15 98,791,907 (GRCm39) missense possibly damaging 0.84
R7032:Dhh UTSW 15 98,791,907 (GRCm39) missense possibly damaging 0.84
R7330:Dhh UTSW 15 98,792,291 (GRCm39) missense probably damaging 1.00
R8975:Dhh UTSW 15 98,795,976 (GRCm39) missense probably damaging 1.00
R9228:Dhh UTSW 15 98,795,757 (GRCm39) nonsense probably null
R9755:Dhh UTSW 15 98,792,939 (GRCm39) missense possibly damaging 0.53
X0060:Dhh UTSW 15 98,792,190 (GRCm39) missense possibly damaging 0.95
Z1088:Dhh UTSW 15 98,792,790 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAACTCCTCGGCCAAGCGGTAAAG -3'
(R):5'- TTGCAGATAACTCACTGGCGGTCC -3'

Sequencing Primer
(F):5'- TGACTCTCTAGAACCGCGTAG -3'
(R):5'- AACTACATCGTGGTGACTGG -3'
Posted On 2014-11-19