Incidental Mutation 'R1426:Lrrc34'
ID250614
Institutional Source Beutler Lab
Gene Symbol Lrrc34
Ensembl Gene ENSMUSG00000027702
Gene Nameleucine rich repeat containing 34
Synonyms
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1426 (G1)
Quality Score29
Status Validated
Chromosome3
Chromosomal Location30624267-30647869 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 30643579 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029252] [ENSMUST00000108265] [ENSMUST00000108267] [ENSMUST00000172350]
Predicted Effect probably benign
Transcript: ENSMUST00000029252
SMART Domains Protein: ENSMUSP00000029252
Gene: ENSMUSG00000027702

DomainStartEndE-ValueType
LRR 73 100 2.23e2 SMART
LRR 101 128 6.92e-1 SMART
LRR 129 156 1.78e0 SMART
LRR 157 184 1.67e-2 SMART
Blast:LRR 216 242 2e-9 BLAST
LRR 244 271 2.57e-3 SMART
LRR 272 299 5.59e-4 SMART
LRR 301 328 4.16e0 SMART
LRR 329 356 1.66e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108265
SMART Domains Protein: ENSMUSP00000103900
Gene: ENSMUSG00000027703

DomainStartEndE-ValueType
LRR 68 90 7.05e-1 SMART
LRR 91 114 1.19e1 SMART
Pfam:LRR_7 115 133 1.1e-1 PFAM
LRR 138 161 9.75e0 SMART
LRR 162 185 8.72e0 SMART
LRR 208 230 3.47e0 SMART
LRR 231 254 9.3e-1 SMART
LRR 255 276 1.22e2 SMART
LRR 277 300 4.83e0 SMART
LRR 323 345 6.22e0 SMART
LRR 346 368 6.4e0 SMART
LRR 369 392 1.51e0 SMART
LRR 418 440 2.03e1 SMART
LRR 441 464 2.82e0 SMART
IQ 524 546 8.84e-3 SMART
low complexity region 553 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108267
SMART Domains Protein: ENSMUSP00000103902
Gene: ENSMUSG00000027703

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
Pfam:LRR_7 130 148 1.2e-1 PFAM
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172350
SMART Domains Protein: ENSMUSP00000127052
Gene: ENSMUSG00000027703

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Lrrc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Lrrc34 APN 3 30645245 missense probably benign 0.12
IGL02738:Lrrc34 APN 3 30631292 missense possibly damaging 0.82
IGL02985:Lrrc34 APN 3 30636295 missense probably benign 0.32
IGL02999:Lrrc34 APN 3 30634633 missense probably damaging 0.99
R0367:Lrrc34 UTSW 3 30629993 missense probably benign 0.08
R0761:Lrrc34 UTSW 3 30631276 splice site probably null
R1980:Lrrc34 UTSW 3 30642741 missense probably benign 0.33
R2215:Lrrc34 UTSW 3 30643529 missense probably benign 0.03
R2414:Lrrc34 UTSW 3 30634562 missense probably benign 0.00
R4379:Lrrc34 UTSW 3 30631375 missense probably damaging 1.00
R5214:Lrrc34 UTSW 3 30636248 nonsense probably null
R5418:Lrrc34 UTSW 3 30642774 missense possibly damaging 0.85
R5662:Lrrc34 UTSW 3 30631324 missense probably benign 0.03
R6736:Lrrc34 UTSW 3 30624859 missense probably benign 0.03
R6809:Lrrc34 UTSW 3 30634600 missense possibly damaging 0.80
R6941:Lrrc34 UTSW 3 30624820 missense probably benign 0.01
R7017:Lrrc34 UTSW 3 30645316 critical splice acceptor site probably null
R7080:Lrrc34 UTSW 3 30634556 missense probably damaging 0.96
R7139:Lrrc34 UTSW 3 30624887 missense probably benign 0.22
R7191:Lrrc34 UTSW 3 30624878 missense possibly damaging 0.61
R7398:Lrrc34 UTSW 3 30643342 missense probably damaging 1.00
R7662:Lrrc34 UTSW 3 30643303 missense probably benign 0.16
R7707:Lrrc34 UTSW 3 30624892 missense probably benign 0.00
R7945:Lrrc34 UTSW 3 30642737 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAAAGCAGGCCGTGTTTACCAG -3'
(R):5'- tgtacgccaacaGAGAGCCTAACC -3'

Sequencing Primer
(F):5'- CCGTGTTTACCAGCAAGC -3'
(R):5'- CCTGGATTGCAAAGACTCTGGTA -3'
Posted On2014-11-26