Mutagenetix > Incidental Mutation

Incidental Mutation 'R2483:Thsd7b'

250624

Institutional Source

Beutler Lab

Gene Symbol

Thsd7b

Ensembl Gene

ENSMUSG00000042581

Gene Name

thrombospondin, type I, domain containing 7B

Synonyms

1700074E13Rik, D130067I03Rik

MMRRC Submission

040407-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R2483 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129273302-130219278 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 130103072 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1048 (V1048D)

Ref Sequence

ENSEMBL: ENSMUSP00000073220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073527]

AlphaFold

Q6P4U0

Predicted Effect

probably damaging
Transcript: ENSMUST00000073527
AA Change: V1048D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: V1048D

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
Blast:TSP1	43	98	5e-29	BLAST
Blast:TSP1	122	177	9e-24	BLAST
TSP1	182	233	2.47e-9	SMART
TSP1	339	399	7e-9	SMART
Blast:TSP1	402	482	2e-27	BLAST
TSP1	487	543	2.12e-1	SMART
TSP1	604	661	3.9e-7	SMART
TSP1	664	735	2.73e-2	SMART
TSP1	740	796	1.01e-5	SMART
Blast:TSP1	799	869	6e-35	BLAST
TSP1	874	922	9.68e-3	SMART
TSP1	952	999	2.42e0	SMART
TSP1	1004	1059	3.96e-8	SMART
TSP1	1062	1126	1.73e0	SMART
TSP1	1131	1182	6.05e-4	SMART
TSP1	1185	1246	9.52e-1	SMART
TSP1	1251	1303	3.21e-8	SMART
TSP1	1304	1369	5.52e-1	SMART
TSP1	1374	1432	3.92e-2	SMART
transmembrane domain	1558	1580	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151700

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230050P20Rik	A	T	9: 20,873,177	I186F	possibly damaging	Het
Adcy1	A	G	11: 7,130,348	T364A	probably benign	Het
Adpgk	G	A	9: 59,313,753	V281I	probably benign	Het
Akap9	C	A	5: 3,976,235	Q1297K	possibly damaging	Het
Ankrd13d	T	C	19: 4,281,940	E110G	probably damaging	Het
Ankrd53	A	G	6: 83,763,262	E104G	possibly damaging	Het
Ano6	A	T	15: 95,965,974	T792S	probably benign	Het
Atm	A	T	9: 53,510,266	V715D	probably damaging	Het
Avl9	A	G	6: 56,736,843	D362G	probably benign	Het
Bin1	T	A	18: 32,414,227	S152R	probably damaging	Het
Bscl2	T	A	19: 8,841,150	C40S	probably benign	Het
Btaf1	A	G	19: 36,981,086	T668A	probably benign	Het
Btrc	A	G	19: 45,516,058	D397G	probably damaging	Het
C530008M17Rik	A	T	5: 76,856,409	I206F	probably damaging	Het
Cables2	A	T	2: 180,260,429	V379E	probably damaging	Het
Cacna2d2	T	C	9: 107,512,022	L228P	probably damaging	Het
Cd109	A	T	9: 78,667,357	D541V	probably damaging	Het
Cdh26	A	T	2: 178,466,589	S327C	probably damaging	Het
Cep78	T	C	19: 15,960,980	K535E	probably damaging	Het
Ces1a	A	G	8: 93,027,341	Y345H	probably damaging	Het
Col6a5	C	A	9: 105,864,148	R2524I	probably damaging	Het
Dctn1	G	A	6: 83,194,187	R661H	probably damaging	Het
Ddias	T	C	7: 92,859,592	T372A	probably benign	Het
Dffb	T	C	4: 153,965,519	T296A	probably damaging	Het
Dock8	A	G	19: 25,079,877	Q216R	probably benign	Het
Emx1	T	C	6: 85,188,255	S105P	probably benign	Het
Ep400	T	C	5: 110,719,236	Y1014C	unknown	Het
Fam193a	A	T	5: 34,465,758	K1230M	possibly damaging	Het
Fgf9	A	G	14: 58,109,571	Q207R	probably benign	Het
Gm5460	G	A	14: 34,045,818	C461Y	possibly damaging	Het
Gpc1	T	C	1: 92,855,938	I249T	probably benign	Het
Htr1d	T	C	4: 136,443,504	I348T	probably damaging	Het
Hyal4	A	T	6: 24,765,738	S364C	probably damaging	Het
Igfn1	T	C	1: 135,969,537	E1097G	probably benign	Het
Igkv1-133	A	T	6: 67,724,960	Q16L	probably benign	Het
Kcnh5	A	T	12: 75,114,471	I221N	probably damaging	Het
Kmt2a	A	G	9: 44,848,966	Y529H	probably damaging	Het
Kyat1	T	C	2: 30,186,698	H218R	possibly damaging	Het
Lamb2	T	G	9: 108,480,559	C94G	probably damaging	Het
Met	A	T	6: 17,549,086	D979V	probably damaging	Het
Midn	A	G	10: 80,150,310	D78G	probably benign	Het
Myh1	A	T	11: 67,211,226	M811L	probably benign	Het
Myh7	T	C	14: 54,973,381	E1693G	probably damaging	Het
Myo15b	A	G	11: 115,864,739	T979A	probably benign	Het
Myo18b	A	T	5: 112,858,408	C879S	probably damaging	Het
Myom1	A	G	17: 71,077,812	T733A	probably damaging	Het
Ndufa9	A	T	6: 126,844,399	M76K	possibly damaging	Het
Nectin3	A	G	16: 46,395,179	C74R	possibly damaging	Het
Obscn	A	G	11: 59,080,146	F2514L	probably damaging	Het
Olfr1241	G	A	2: 89,483,127	Q3*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr653	T	C	7: 104,579,942	S99P	probably damaging	Het
P2ry2	A	T	7: 100,998,499	S200T	probably benign	Het
Pcdha5	G	T	18: 36,961,489	M350I	probably benign	Het
Pcdha5	G	A	18: 36,961,781	V448M	probably damaging	Het
Pex12	C	T	11: 83,297,629	R180H	possibly damaging	Het
Pkd1l1	A	T	11: 8,962,701	V168E	probably damaging	Het
Prokr2	T	A	2: 132,381,175	D149V	probably damaging	Het
Rnf123	A	G	9: 108,063,521	V707A	probably benign	Het
Ryr2	T	C	13: 11,759,703	E1189G	probably damaging	Het
Scarf1	T	C	11: 75,515,291	F134L	probably damaging	Het
Sfxn5	A	G	6: 85,332,278		probably null	Het
Slc17a5	A	T	9: 78,538,274	V433D	probably damaging	Het
Snapc1	A	G	12: 73,964,643	T28A	probably benign	Het
Soat1	T	C	1: 156,431,099	Y528C	probably damaging	Het
Spem1	G	A	11: 69,821,518	R107C	possibly damaging	Het
Srcap	T	C	7: 127,542,147	S1639P	probably damaging	Het
Sycp2	A	T	2: 178,374,595	N691K	probably damaging	Het
Syne2	A	T	12: 76,095,537	I6183F	probably damaging	Het
Tas2r110	A	T	6: 132,868,470	M155L	probably benign	Het
Tenm3	G	A	8: 48,240,270	T1859I	probably damaging	Het
Tmem55b	C	G	14: 50,930,292	V59L	probably damaging	Het
Ttc37	A	G	13: 76,182,867	E1472G	probably damaging	Het
Vav3	T	C	3: 109,341,166	L43P	probably damaging	Het
Vmn1r30	A	T	6: 58,435,452	F132I	probably benign	Het
Vmn2r24	A	G	6: 123,816,038	R775G	probably damaging	Het
Vps13c	T	A	9: 67,975,907		probably null	Het
Vps37c	T	A	19: 10,706,205		probably null	Het
Wwp2	A	G	8: 107,548,535	D388G	probably damaging	Het
Xirp2	A	T	2: 67,524,992	T3366S	probably benign	Het
Zbtb49	A	C	5: 38,203,357		probably benign	Het

Other mutations in Thsd7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Thsd7b	APN	1	129595834	missense	probably damaging	1.00
IGL00850:Thsd7b	APN	1	130165077	missense	probably benign	0.00
IGL00987:Thsd7b	APN	1	129613279	missense	probably damaging	1.00
IGL01068:Thsd7b	APN	1	129596146	missense	probably damaging	1.00
IGL01091:Thsd7b	APN	1	129776334	missense	probably benign	0.29
IGL01535:Thsd7b	APN	1	129678217	missense	possibly damaging	0.64
IGL01560:Thsd7b	APN	1	130218181	utr 3 prime	probably benign
IGL01701:Thsd7b	APN	1	129430928	missense	probably benign	0.07
IGL01775:Thsd7b	APN	1	129628939	missense	probably damaging	0.99
IGL02077:Thsd7b	APN	1	129816682	missense	probably damaging	1.00
IGL02338:Thsd7b	APN	1	129595771	missense	probably damaging	1.00
IGL02340:Thsd7b	APN	1	130159632	missense	probably benign	0.01
IGL02404:Thsd7b	APN	1	129613151	missense	probably damaging	1.00
IGL02519:Thsd7b	APN	1	129613195	missense	probably benign	0.22
IGL02543:Thsd7b	APN	1	130165103	missense	probably benign	0.03
IGL02740:Thsd7b	APN	1	129613127	missense	probably damaging	0.99
IGL02793:Thsd7b	APN	1	129951393	missense	probably damaging	1.00
IGL02875:Thsd7b	APN	1	129951393	missense	probably damaging	1.00
IGL02986:Thsd7b	APN	1	129915615	missense	probably benign	0.01
IGL03108:Thsd7b	APN	1	130210276	missense	probably damaging	1.00
IGL03114:Thsd7b	APN	1	130188551	missense	probably benign	0.00
IGL03195:Thsd7b	APN	1	129628909	missense	probably damaging	1.00
IGL03291:Thsd7b	APN	1	129760355	missense	possibly damaging	0.94
IGL03397:Thsd7b	APN	1	129596164	missense	probably benign	0.17
IGL03399:Thsd7b	APN	1	129628885	missense	probably damaging	1.00
R0184:Thsd7b	UTSW	1	129430964	missense	probably benign	0.00
R0277:Thsd7b	UTSW	1	130195263	missense	probably benign	0.00
R0526:Thsd7b	UTSW	1	129951392	missense	probably damaging	1.00
R0633:Thsd7b	UTSW	1	130188526	missense	possibly damaging	0.78
R0746:Thsd7b	UTSW	1	130188531	missense	probably benign	0.00
R0784:Thsd7b	UTSW	1	129595359	splice site	probably benign
R1158:Thsd7b	UTSW	1	130189935	splice site	probably null
R1267:Thsd7b	UTSW	1	129628840	splice site	probably null
R1375:Thsd7b	UTSW	1	130159686	missense	probably damaging	1.00
R1565:Thsd7b	UTSW	1	129596041	missense	possibly damaging	0.94
R1728:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1728:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1728:Thsd7b	UTSW	1	129678183	missense	probably benign
R1728:Thsd7b	UTSW	1	130116631	missense	probably benign
R1729:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1729:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1729:Thsd7b	UTSW	1	129678183	missense	probably benign
R1729:Thsd7b	UTSW	1	130116631	missense	probably benign
R1730:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1730:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1730:Thsd7b	UTSW	1	129678183	missense	probably benign
R1730:Thsd7b	UTSW	1	130116631	missense	probably benign
R1739:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1739:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1739:Thsd7b	UTSW	1	129678183	missense	probably benign
R1739:Thsd7b	UTSW	1	130116631	missense	probably benign
R1762:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1762:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1762:Thsd7b	UTSW	1	129678183	missense	probably benign
R1762:Thsd7b	UTSW	1	130103076	missense	possibly damaging	0.92
R1762:Thsd7b	UTSW	1	130116631	missense	probably benign
R1783:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1783:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1783:Thsd7b	UTSW	1	129678183	missense	probably benign
R1783:Thsd7b	UTSW	1	130116631	missense	probably benign
R1784:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1784:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1784:Thsd7b	UTSW	1	129678183	missense	probably benign
R1784:Thsd7b	UTSW	1	130116631	missense	probably benign
R1785:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1785:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1785:Thsd7b	UTSW	1	129678183	missense	probably benign
R1785:Thsd7b	UTSW	1	130116631	missense	probably benign
R1812:Thsd7b	UTSW	1	129758610	missense	probably damaging	1.00
R1846:Thsd7b	UTSW	1	129613256	missense	probably damaging	1.00
R1908:Thsd7b	UTSW	1	129678109	missense	probably damaging	0.99
R1996:Thsd7b	UTSW	1	129758451	nonsense	probably null
R2199:Thsd7b	UTSW	1	130218158	missense	probably benign	0.04
R2919:Thsd7b	UTSW	1	130189850	splice site	probably benign
R2935:Thsd7b	UTSW	1	129678087	missense	possibly damaging	0.83
R3113:Thsd7b	UTSW	1	130049862	missense	probably benign	0.23
R3236:Thsd7b	UTSW	1	130218118	nonsense	probably null
R3745:Thsd7b	UTSW	1	129678241	missense	probably benign	0.04
R3877:Thsd7b	UTSW	1	130190182	missense	possibly damaging	0.92
R3880:Thsd7b	UTSW	1	129595370	missense	probably damaging	1.00
R4110:Thsd7b	UTSW	1	130116619	missense	probably benign	0.18
R4112:Thsd7b	UTSW	1	130116619	missense	probably benign	0.18
R4255:Thsd7b	UTSW	1	129760287	missense	possibly damaging	0.79
R4621:Thsd7b	UTSW	1	129430915	missense	possibly damaging	0.47
R4703:Thsd7b	UTSW	1	130049909	intron	probably benign
R4732:Thsd7b	UTSW	1	129613186	missense	probably damaging	1.00
R4733:Thsd7b	UTSW	1	129613186	missense	probably damaging	1.00
R4755:Thsd7b	UTSW	1	130210264	missense	probably benign	0.01
R4805:Thsd7b	UTSW	1	130188539	missense	probably benign	0.04
R4840:Thsd7b	UTSW	1	129595844	missense	probably benign	0.00
R4879:Thsd7b	UTSW	1	130188499	missense	possibly damaging	0.62
R4936:Thsd7b	UTSW	1	129678145	missense	probably benign	0.00
R4972:Thsd7b	UTSW	1	130188572	missense	probably damaging	0.97
R5304:Thsd7b	UTSW	1	129678243	nonsense	probably null
R5422:Thsd7b	UTSW	1	129921334	missense	probably benign	0.41
R5495:Thsd7b	UTSW	1	129595833	missense	probably damaging	1.00
R5598:Thsd7b	UTSW	1	129595841	missense	probably damaging	1.00
R5620:Thsd7b	UTSW	1	130162936	critical splice donor site	probably null
R5638:Thsd7b	UTSW	1	129595533	missense	probably benign	0.00
R5640:Thsd7b	UTSW	1	130116671	nonsense	probably null
R5655:Thsd7b	UTSW	1	129628934	splice site	probably null
R5711:Thsd7b	UTSW	1	129760402	missense	probably damaging	1.00
R5823:Thsd7b	UTSW	1	129678084	missense	probably benign	0.00
R5888:Thsd7b	UTSW	1	130210320	nonsense	probably null
R5932:Thsd7b	UTSW	1	129430838	missense	probably benign
R6243:Thsd7b	UTSW	1	130162862	missense	probably benign	0.21
R6258:Thsd7b	UTSW	1	129667918	missense	probably benign
R6260:Thsd7b	UTSW	1	129667918	missense	probably benign
R6399:Thsd7b	UTSW	1	129816648	missense	probably benign	0.13
R6437:Thsd7b	UTSW	1	129816682	missense	probably damaging	1.00
R6719:Thsd7b	UTSW	1	130159714	splice site	probably null
R6785:Thsd7b	UTSW	1	129430907	missense	probably damaging	0.99
R7304:Thsd7b	UTSW	1	130103153	missense	probably benign	0.01
R7334:Thsd7b	UTSW	1	130195275	missense	probably benign	0.00
R7414:Thsd7b	UTSW	1	129628980	missense	probably damaging	0.99
R7673:Thsd7b	UTSW	1	129915750	splice site	probably null
R7683:Thsd7b	UTSW	1	129595946	missense	probably damaging	0.99
R7861:Thsd7b	UTSW	1	130159698	missense	probably benign	0.00
R8145:Thsd7b	UTSW	1	129760299	missense	probably damaging	1.00
R8241:Thsd7b	UTSW	1	130189951	missense	probably damaging	1.00
R8296:Thsd7b	UTSW	1	129595456	missense	probably benign	0.01
R8355:Thsd7b	UTSW	1	129595879	missense	probably damaging	1.00
R8507:Thsd7b	UTSW	1	129678053	missense	probably benign	0.21
R8520:Thsd7b	UTSW	1	129921420	missense	probably benign	0.07
R8555:Thsd7b	UTSW	1	129595454	missense	probably damaging	1.00
R8682:Thsd7b	UTSW	1	129760274	nonsense	probably null
R8981:Thsd7b	UTSW	1	129595450	missense	possibly damaging	0.88
R9029:Thsd7b	UTSW	1	130159689	missense	probably damaging	1.00
R9133:Thsd7b	UTSW	1	129915645	missense	probably benign	0.18
R9194:Thsd7b	UTSW	1	129915634	missense	possibly damaging	0.78
R9229:Thsd7b	UTSW	1	129921290	missense	probably damaging	1.00
R9239:Thsd7b	UTSW	1	130159716	critical splice donor site	probably null
R9460:Thsd7b	UTSW	1	130162937	critical splice donor site	probably null
R9466:Thsd7b	UTSW	1	130195129	missense	probably benign
R9588:Thsd7b	UTSW	1	130180486	missense	probably damaging	1.00
X0027:Thsd7b	UTSW	1	129596072	missense	probably benign	0.00
Z1176:Thsd7b	UTSW	1	129595516	missense	probably damaging	0.98
Z1176:Thsd7b	UTSW	1	129595660	missense	probably benign	0.01
Z1176:Thsd7b	UTSW	1	129628911	missense	probably benign	0.17
Z1176:Thsd7b	UTSW	1	130180424	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- CTTCTTCAGGTAGCGCACTC -3'
(R):5'- GGTAGGAGGGCTACATTTGC -3'

Sequencing Primer
(F):5'- TTCAGGTAGCGCACTCAATTCAG -3'
(R):5'- TCATGTACCTGGAAACAAAGCTG -3'

Posted On

2014-12-04