Incidental Mutation 'R2483:Cdh26'
ID 250633
Institutional Source Beutler Lab
Gene Symbol Cdh26
Ensembl Gene ENSMUSG00000039155
Gene Name cadherin-like 26
Synonyms LOC381409
MMRRC Submission 040407-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2483 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 178430531-178487366 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 178466589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 327 (S327C)
Ref Sequence ENSEMBL: ENSMUSP00000104540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042092] [ENSMUST00000108912]
AlphaFold P59862
Predicted Effect probably damaging
Transcript: ENSMUST00000042092
AA Change: S327C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048829
Gene: ENSMUSG00000039155
AA Change: S327C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108912
AA Change: S327C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104540
Gene: ENSMUSG00000039155
AA Change: S327C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 36 138 5.06e-2 SMART
CA 162 248 1.23e-19 SMART
CA 271 370 1.01e-6 SMART
CA 393 476 2.86e-20 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176869
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cadherin protein family. Cadherins are a family of calcium-dependent adhesion molecules that mediate cell-cell adhesion in all solid tissues and modulate a wide variety of processes, including cell polarization, migration and differentiation. Cadherin domains occur as repeats in the extracellular region and are thought to contribute to the sorting of heterogeneous cell types and the maintenance of orderly structures such as epithelium. This protein is expressed in gastrointestinal epithelial cells and may be upregulated during allergic inflammation. This protein interacts with alpha integrins and may also be involved in leukocyte migration and adhesion. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik A T 9: 20,873,177 I186F possibly damaging Het
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Ano6 A T 15: 95,965,974 T792S probably benign Het
Atm A T 9: 53,510,266 V715D probably damaging Het
Avl9 A G 6: 56,736,843 D362G probably benign Het
Bin1 T A 18: 32,414,227 S152R probably damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Btrc A G 19: 45,516,058 D397G probably damaging Het
C530008M17Rik A T 5: 76,856,409 I206F probably damaging Het
Cables2 A T 2: 180,260,429 V379E probably damaging Het
Cacna2d2 T C 9: 107,512,022 L228P probably damaging Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep78 T C 19: 15,960,980 K535E probably damaging Het
Ces1a A G 8: 93,027,341 Y345H probably damaging Het
Col6a5 C A 9: 105,864,148 R2524I probably damaging Het
Dctn1 G A 6: 83,194,187 R661H probably damaging Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emx1 T C 6: 85,188,255 S105P probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Fam193a A T 5: 34,465,758 K1230M possibly damaging Het
Fgf9 A G 14: 58,109,571 Q207R probably benign Het
Gm5460 G A 14: 34,045,818 C461Y possibly damaging Het
Gpc1 T C 1: 92,855,938 I249T probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igfn1 T C 1: 135,969,537 E1097G probably benign Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Kcnh5 A T 12: 75,114,471 I221N probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kyat1 T C 2: 30,186,698 H218R possibly damaging Het
Lamb2 T G 9: 108,480,559 C94G probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Myh1 A T 11: 67,211,226 M811L probably benign Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Myo15b A G 11: 115,864,739 T979A probably benign Het
Myo18b A T 5: 112,858,408 C879S probably damaging Het
Myom1 A G 17: 71,077,812 T733A probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nectin3 A G 16: 46,395,179 C74R possibly damaging Het
Obscn A G 11: 59,080,146 F2514L probably damaging Het
Olfr1241 G A 2: 89,483,127 Q3* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcdha5 G T 18: 36,961,489 M350I probably benign Het
Pcdha5 G A 18: 36,961,781 V448M probably damaging Het
Pex12 C T 11: 83,297,629 R180H possibly damaging Het
Pkd1l1 A T 11: 8,962,701 V168E probably damaging Het
Prokr2 T A 2: 132,381,175 D149V probably damaging Het
Rnf123 A G 9: 108,063,521 V707A probably benign Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Scarf1 T C 11: 75,515,291 F134L probably damaging Het
Sfxn5 A G 6: 85,332,278 probably null Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Snapc1 A G 12: 73,964,643 T28A probably benign Het
Soat1 T C 1: 156,431,099 Y528C probably damaging Het
Spem1 G A 11: 69,821,518 R107C possibly damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Sycp2 A T 2: 178,374,595 N691K probably damaging Het
Syne2 A T 12: 76,095,537 I6183F probably damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Tenm3 G A 8: 48,240,270 T1859I probably damaging Het
Thsd7b T A 1: 130,103,072 V1048D probably damaging Het
Tmem55b C G 14: 50,930,292 V59L probably damaging Het
Ttc37 A G 13: 76,182,867 E1472G probably damaging Het
Vav3 T C 3: 109,341,166 L43P probably damaging Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Wwp2 A G 8: 107,548,535 D388G probably damaging Het
Xirp2 A T 2: 67,524,992 T3366S probably benign Het
Zbtb49 A C 5: 38,203,357 probably benign Het
Other mutations in Cdh26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cdh26 APN 2 178481624 missense possibly damaging 0.86
IGL01341:Cdh26 APN 2 178457447 missense probably damaging 0.99
IGL02636:Cdh26 APN 2 178449962 missense probably damaging 1.00
IGL03144:Cdh26 APN 2 178468174 missense probably damaging 0.99
R0244:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0245:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0466:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0467:Cdh26 UTSW 2 178481632 missense possibly damaging 0.88
R0514:Cdh26 UTSW 2 178466828 critical splice donor site probably null
R0610:Cdh26 UTSW 2 178449898 missense probably damaging 1.00
R0733:Cdh26 UTSW 2 178486931 missense probably damaging 1.00
R1592:Cdh26 UTSW 2 178449891 missense probably damaging 1.00
R3756:Cdh26 UTSW 2 178470001 splice site probably benign
R4617:Cdh26 UTSW 2 178460642 intron probably benign
R4914:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4915:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4917:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R4918:Cdh26 UTSW 2 178449821 missense probably benign 0.02
R5086:Cdh26 UTSW 2 178441417 nonsense probably null
R5573:Cdh26 UTSW 2 178466689 missense probably damaging 0.96
R5809:Cdh26 UTSW 2 178460126 nonsense probably null
R5941:Cdh26 UTSW 2 178481650 nonsense probably null
R6284:Cdh26 UTSW 2 178449884 missense probably damaging 1.00
R6341:Cdh26 UTSW 2 178471573 splice site probably null
R6496:Cdh26 UTSW 2 178449861 missense probably damaging 1.00
R7132:Cdh26 UTSW 2 178486762 missense possibly damaging 0.56
R7664:Cdh26 UTSW 2 178470042 missense probably benign 0.02
R7694:Cdh26 UTSW 2 178460103 missense probably damaging 0.96
R7814:Cdh26 UTSW 2 178470035 missense probably damaging 0.98
R8089:Cdh26 UTSW 2 178457577 critical splice donor site probably null
R8103:Cdh26 UTSW 2 178468213 missense probably damaging 1.00
R8412:Cdh26 UTSW 2 178462724 missense probably damaging 0.98
R8413:Cdh26 UTSW 2 178468229 missense probably damaging 0.99
R9025:Cdh26 UTSW 2 178462616 missense probably benign 0.01
RF002:Cdh26 UTSW 2 178466631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCATAAGTGATTTGAAAGG -3'
(R):5'- CACCTTATCTGGCTGTCAGC -3'

Sequencing Primer
(F):5'- CCCATAAGTGATTTGAAAGGGATCTG -3'
(R):5'- GTCTGTAGCATTGAAGTATCCCAGC -3'
Posted On 2014-12-04