Incidental Mutation 'R2483:Vav3'
ID250635
Institutional Source Beutler Lab
Gene Symbol Vav3
Ensembl Gene ENSMUSG00000033721
Gene Namevav 3 oncogene
SynonymsIdd18.1, A530094I06Rik
MMRRC Submission 040407-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R2483 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location109340653-109685698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109341166 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 43 (L43P)
Ref Sequence ENSEMBL: ENSMUSP00000036270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046864]
Predicted Effect probably damaging
Transcript: ENSMUST00000046864
AA Change: L43P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036270
Gene: ENSMUSG00000033721
AA Change: L43P

DomainStartEndE-ValueType
CH 3 115 2.1e-18 SMART
low complexity region 160 175 N/A INTRINSIC
RhoGEF 196 370 5.09e-56 SMART
PH 401 504 1.88e-9 SMART
C1 514 562 2.17e-11 SMART
SH3 595 659 6.4e-6 SMART
SH2 670 752 2.59e-26 SMART
SH3 791 847 8.96e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137871
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. This gene product acts as a GEF preferentially for RhoG, RhoA, and to a lesser extent, RAC1, and it associates maximally with the nucleotide-free states of these GTPases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in tachycardia, systemic arterial hypertension, cardiovascular remodeling, hyperactivity of sympathetic neurons and thus high catecholamine levels, and increased levels of kidney-related hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik A T 9: 20,873,177 I186F possibly damaging Het
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Ano6 A T 15: 95,965,974 T792S probably benign Het
Atm A T 9: 53,510,266 V715D probably damaging Het
Avl9 A G 6: 56,736,843 D362G probably benign Het
Bin1 T A 18: 32,414,227 S152R probably damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Btrc A G 19: 45,516,058 D397G probably damaging Het
C530008M17Rik A T 5: 76,856,409 I206F probably damaging Het
Cables2 A T 2: 180,260,429 V379E probably damaging Het
Cacna2d2 T C 9: 107,512,022 L228P probably damaging Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cdh26 A T 2: 178,466,589 S327C probably damaging Het
Cep78 T C 19: 15,960,980 K535E probably damaging Het
Ces1a A G 8: 93,027,341 Y345H probably damaging Het
Col6a5 C A 9: 105,864,148 R2524I probably damaging Het
Dctn1 G A 6: 83,194,187 R661H probably damaging Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emx1 T C 6: 85,188,255 S105P probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Fam193a A T 5: 34,465,758 K1230M possibly damaging Het
Fgf9 A G 14: 58,109,571 Q207R probably benign Het
Gm5460 G A 14: 34,045,818 C461Y possibly damaging Het
Gpc1 T C 1: 92,855,938 I249T probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igfn1 T C 1: 135,969,537 E1097G probably benign Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Kcnh5 A T 12: 75,114,471 I221N probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kyat1 T C 2: 30,186,698 H218R possibly damaging Het
Lamb2 T G 9: 108,480,559 C94G probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Myh1 A T 11: 67,211,226 M811L probably benign Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Myo15b A G 11: 115,864,739 T979A probably benign Het
Myo18b A T 5: 112,858,408 C879S probably damaging Het
Myom1 A G 17: 71,077,812 T733A probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nectin3 A G 16: 46,395,179 C74R possibly damaging Het
Obscn A G 11: 59,080,146 F2514L probably damaging Het
Olfr1241 G A 2: 89,483,127 Q3* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcdha5 G T 18: 36,961,489 M350I probably benign Het
Pcdha5 G A 18: 36,961,781 V448M probably damaging Het
Pex12 C T 11: 83,297,629 R180H possibly damaging Het
Pkd1l1 A T 11: 8,962,701 V168E probably damaging Het
Prokr2 T A 2: 132,381,175 D149V probably damaging Het
Rnf123 A G 9: 108,063,521 V707A probably benign Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Scarf1 T C 11: 75,515,291 F134L probably damaging Het
Sfxn5 A G 6: 85,332,278 probably null Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Snapc1 A G 12: 73,964,643 T28A probably benign Het
Soat1 T C 1: 156,431,099 Y528C probably damaging Het
Spem1 G A 11: 69,821,518 R107C possibly damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Sycp2 A T 2: 178,374,595 N691K probably damaging Het
Syne2 A T 12: 76,095,537 I6183F probably damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Tenm3 G A 8: 48,240,270 T1859I probably damaging Het
Thsd7b T A 1: 130,103,072 V1048D probably damaging Het
Tmem55b C G 14: 50,930,292 V59L probably damaging Het
Ttc37 A G 13: 76,182,867 E1472G probably damaging Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Wwp2 A G 8: 107,548,535 D388G probably damaging Het
Xirp2 A T 2: 67,524,992 T3366S probably benign Het
Zbtb49 A C 5: 38,203,357 probably benign Het
Other mutations in Vav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Vav3 APN 3 109528392 splice site probably benign
IGL01488:Vav3 APN 3 109657944 missense probably damaging 0.99
IGL01649:Vav3 APN 3 109562762 missense probably benign
IGL01675:Vav3 APN 3 109664413 missense probably benign 0.16
IGL02189:Vav3 APN 3 109525960 splice site probably benign
IGL03134:Vav3 APN 3 109563094 splice site probably benign
IGL03358:Vav3 APN 3 109647673 missense probably damaging 1.00
PIT4131001:Vav3 UTSW 3 109664435 critical splice donor site probably null
R0511:Vav3 UTSW 3 109664440 splice site probably benign
R0542:Vav3 UTSW 3 109527430 missense probably damaging 1.00
R0630:Vav3 UTSW 3 109424012 missense probably damaging 1.00
R0683:Vav3 UTSW 3 109651813 missense probably benign 0.04
R0833:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R0836:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R0940:Vav3 UTSW 3 109562835 missense possibly damaging 0.78
R1561:Vav3 UTSW 3 109494838 critical splice donor site probably null
R1617:Vav3 UTSW 3 109510978 missense probably damaging 1.00
R1760:Vav3 UTSW 3 109341127 missense possibly damaging 0.61
R1834:Vav3 UTSW 3 109506426 missense probably benign 0.06
R1928:Vav3 UTSW 3 109506422 missense possibly damaging 0.94
R2090:Vav3 UTSW 3 109647739 critical splice donor site probably null
R2190:Vav3 UTSW 3 109562814 missense probably damaging 1.00
R3124:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3125:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3800:Vav3 UTSW 3 109628039 missense probably benign 0.45
R3919:Vav3 UTSW 3 109527538 missense possibly damaging 0.51
R4693:Vav3 UTSW 3 109563218 splice site probably benign
R4779:Vav3 UTSW 3 109508794 missense possibly damaging 0.88
R5384:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5385:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5474:Vav3 UTSW 3 109664421 missense probably benign
R5703:Vav3 UTSW 3 109341241 missense probably benign 0.13
R5997:Vav3 UTSW 3 109501461 missense probably damaging 1.00
R6109:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6110:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6120:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6123:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6124:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6186:Vav3 UTSW 3 109516067 missense probably damaging 1.00
R6291:Vav3 UTSW 3 109508854 missense possibly damaging 0.82
R6335:Vav3 UTSW 3 109563196 missense probably benign 0.01
R6647:Vav3 UTSW 3 109527416 missense probably benign 0.19
R6849:Vav3 UTSW 3 109521466 missense probably damaging 1.00
R6897:Vav3 UTSW 3 109527494 missense probably damaging 1.00
R7075:Vav3 UTSW 3 109525924 missense possibly damaging 0.47
R7131:Vav3 UTSW 3 109664346 missense probably damaging 1.00
R7328:Vav3 UTSW 3 109503428 missense probably benign 0.10
R7365:Vav3 UTSW 3 109628099 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GAACCAGGGGCCATCAGC -3'
(R):5'- GCGCACCTAGATGTTTGCATT -3'

Sequencing Primer
(F):5'- CCACCTCAGAGTCGCTGC -3'
(R):5'- GCACCTAGATGTTTGCATTTACAC -3'
Posted On2014-12-04