Incidental Mutation 'R2483:Ndufa9'
ID250656
Institutional Source Beutler Lab
Gene Symbol Ndufa9
Ensembl Gene ENSMUSG00000000399
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9
Synonyms
MMRRC Submission 040407-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2483 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location126821721-126849136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126844399 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 76 (M76K)
Ref Sequence ENSEMBL: ENSMUSP00000144904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088194] [ENSMUST00000205002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088194
AA Change: M72K

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085523
Gene: ENSMUSG00000000399
AA Change: M72K

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Pfam:NmrA 56 204 1.9e-13 PFAM
Pfam:Epimerase 56 264 4.7e-11 PFAM
Pfam:3Beta_HSD 57 200 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200890
Predicted Effect possibly damaging
Transcript: ENSMUST00000205002
AA Change: M76K

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144904
Gene: ENSMUSG00000000399
AA Change: M76K

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Pfam:NmrA 56 204 1.9e-13 PFAM
Pfam:Epimerase 56 264 4.7e-11 PFAM
Pfam:3Beta_HSD 57 200 1.4e-11 PFAM
Meta Mutation Damage Score 0.1528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein is a subunit of the hydrophobic protein fraction of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. A pseudogene has been identified on chromosome 12. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik A T 9: 20,873,177 I186F possibly damaging Het
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Ano6 A T 15: 95,965,974 T792S probably benign Het
Atm A T 9: 53,510,266 V715D probably damaging Het
Avl9 A G 6: 56,736,843 D362G probably benign Het
Bin1 T A 18: 32,414,227 S152R probably damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Btrc A G 19: 45,516,058 D397G probably damaging Het
C530008M17Rik A T 5: 76,856,409 I206F probably damaging Het
Cables2 A T 2: 180,260,429 V379E probably damaging Het
Cacna2d2 T C 9: 107,512,022 L228P probably damaging Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cdh26 A T 2: 178,466,589 S327C probably damaging Het
Cep78 T C 19: 15,960,980 K535E probably damaging Het
Ces1a A G 8: 93,027,341 Y345H probably damaging Het
Col6a5 C A 9: 105,864,148 R2524I probably damaging Het
Dctn1 G A 6: 83,194,187 R661H probably damaging Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emx1 T C 6: 85,188,255 S105P probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Fam193a A T 5: 34,465,758 K1230M possibly damaging Het
Fgf9 A G 14: 58,109,571 Q207R probably benign Het
Gm5460 G A 14: 34,045,818 C461Y possibly damaging Het
Gpc1 T C 1: 92,855,938 I249T probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igfn1 T C 1: 135,969,537 E1097G probably benign Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Kcnh5 A T 12: 75,114,471 I221N probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kyat1 T C 2: 30,186,698 H218R possibly damaging Het
Lamb2 T G 9: 108,480,559 C94G probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Myh1 A T 11: 67,211,226 M811L probably benign Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Myo15b A G 11: 115,864,739 T979A probably benign Het
Myo18b A T 5: 112,858,408 C879S probably damaging Het
Myom1 A G 17: 71,077,812 T733A probably damaging Het
Nectin3 A G 16: 46,395,179 C74R possibly damaging Het
Obscn A G 11: 59,080,146 F2514L probably damaging Het
Olfr1241 G A 2: 89,483,127 Q3* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcdha5 G T 18: 36,961,489 M350I probably benign Het
Pcdha5 G A 18: 36,961,781 V448M probably damaging Het
Pex12 C T 11: 83,297,629 R180H possibly damaging Het
Pkd1l1 A T 11: 8,962,701 V168E probably damaging Het
Prokr2 T A 2: 132,381,175 D149V probably damaging Het
Rnf123 A G 9: 108,063,521 V707A probably benign Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Scarf1 T C 11: 75,515,291 F134L probably damaging Het
Sfxn5 A G 6: 85,332,278 probably null Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Snapc1 A G 12: 73,964,643 T28A probably benign Het
Soat1 T C 1: 156,431,099 Y528C probably damaging Het
Spem1 G A 11: 69,821,518 R107C possibly damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Sycp2 A T 2: 178,374,595 N691K probably damaging Het
Syne2 A T 12: 76,095,537 I6183F probably damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Tenm3 G A 8: 48,240,270 T1859I probably damaging Het
Thsd7b T A 1: 130,103,072 V1048D probably damaging Het
Tmem55b C G 14: 50,930,292 V59L probably damaging Het
Ttc37 A G 13: 76,182,867 E1472G probably damaging Het
Vav3 T C 3: 109,341,166 L43P probably damaging Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Wwp2 A G 8: 107,548,535 D388G probably damaging Het
Xirp2 A T 2: 67,524,992 T3366S probably benign Het
Zbtb49 A C 5: 38,203,357 probably benign Het
Other mutations in Ndufa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Ndufa9 APN 6 126844814 missense probably damaging 1.00
IGL02167:Ndufa9 APN 6 126844785 splice site probably benign
IGL02206:Ndufa9 APN 6 126844403 nonsense probably null
IGL03186:Ndufa9 APN 6 126844892 missense possibly damaging 0.47
IGL03356:Ndufa9 APN 6 126844850 missense possibly damaging 0.89
R0310:Ndufa9 UTSW 6 126827532 splice site probably benign
R1118:Ndufa9 UTSW 6 126822068 missense probably damaging 1.00
R1119:Ndufa9 UTSW 6 126822068 missense probably damaging 1.00
R1714:Ndufa9 UTSW 6 126822191 critical splice acceptor site probably null
R2207:Ndufa9 UTSW 6 126844809 missense probably damaging 1.00
R3617:Ndufa9 UTSW 6 126849108 unclassified probably benign
R3623:Ndufa9 UTSW 6 126844399 missense possibly damaging 0.48
R4619:Ndufa9 UTSW 6 126827535 splice site probably null
R4855:Ndufa9 UTSW 6 126827542 nonsense probably null
R4931:Ndufa9 UTSW 6 126836320 missense probably damaging 1.00
R4965:Ndufa9 UTSW 6 126822063 missense probably benign 0.01
R5109:Ndufa9 UTSW 6 126832557 splice site probably null
R7373:Ndufa9 UTSW 6 126834458 missense probably damaging 1.00
Z1176:Ndufa9 UTSW 6 126844815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTCTGGGGTTAAACTATTGC -3'
(R):5'- TGAGGACATTCATGCTTCCTC -3'

Sequencing Primer
(F):5'- GGGTTAAACTATTGCTTCATTACACC -3'
(R):5'- GCATCGTTAGTGTGTCAGA -3'
Posted On2014-12-04