Incidental Mutation 'R2483:Wwp2'
ID250666
Institutional Source Beutler Lab
Gene Symbol Wwp2
Ensembl Gene ENSMUSG00000031930
Gene NameWW domain containing E3 ubiquitin protein ligase 2
SynonymsAIP2, 1300010O06Rik
MMRRC Submission 040407-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R2483 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107436365-107558595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107548535 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 388 (D388G)
Ref Sequence ENSEMBL: ENSMUSP00000148679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166615] [ENSMUST00000212205] [ENSMUST00000212543]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083505
Predicted Effect probably damaging
Transcript: ENSMUST00000166615
AA Change: D434G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132224
Gene: ENSMUSG00000031930
AA Change: D434G

DomainStartEndE-ValueType
C2 19 115 1.52e-6 SMART
low complexity region 188 208 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
WW 301 330 4.61e-8 SMART
WW 331 363 4.33e-13 SMART
WW 406 437 2.86e-13 SMART
WW 445 477 3.6e-10 SMART
HECTc 534 870 3.24e-201 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212063
Predicted Effect probably damaging
Transcript: ENSMUST00000212205
AA Change: D388G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212993
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body size, domed skull, short snout, twisted snout and overgrown mandibular incisors. Mice homozygous for a different knock-out allele exhibit increased sensitivity to pIpC-treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik A T 9: 20,873,177 I186F possibly damaging Het
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Ano6 A T 15: 95,965,974 T792S probably benign Het
Atm A T 9: 53,510,266 V715D probably damaging Het
Avl9 A G 6: 56,736,843 D362G probably benign Het
Bin1 T A 18: 32,414,227 S152R probably damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Btrc A G 19: 45,516,058 D397G probably damaging Het
C530008M17Rik A T 5: 76,856,409 I206F probably damaging Het
Cables2 A T 2: 180,260,429 V379E probably damaging Het
Cacna2d2 T C 9: 107,512,022 L228P probably damaging Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cdh26 A T 2: 178,466,589 S327C probably damaging Het
Cep78 T C 19: 15,960,980 K535E probably damaging Het
Ces1a A G 8: 93,027,341 Y345H probably damaging Het
Col6a5 C A 9: 105,864,148 R2524I probably damaging Het
Dctn1 G A 6: 83,194,187 R661H probably damaging Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emx1 T C 6: 85,188,255 S105P probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Fam193a A T 5: 34,465,758 K1230M possibly damaging Het
Fgf9 A G 14: 58,109,571 Q207R probably benign Het
Gm5460 G A 14: 34,045,818 C461Y possibly damaging Het
Gpc1 T C 1: 92,855,938 I249T probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igfn1 T C 1: 135,969,537 E1097G probably benign Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Kcnh5 A T 12: 75,114,471 I221N probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kyat1 T C 2: 30,186,698 H218R possibly damaging Het
Lamb2 T G 9: 108,480,559 C94G probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Myh1 A T 11: 67,211,226 M811L probably benign Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Myo15b A G 11: 115,864,739 T979A probably benign Het
Myo18b A T 5: 112,858,408 C879S probably damaging Het
Myom1 A G 17: 71,077,812 T733A probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nectin3 A G 16: 46,395,179 C74R possibly damaging Het
Obscn A G 11: 59,080,146 F2514L probably damaging Het
Olfr1241 G A 2: 89,483,127 Q3* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcdha5 G T 18: 36,961,489 M350I probably benign Het
Pcdha5 G A 18: 36,961,781 V448M probably damaging Het
Pex12 C T 11: 83,297,629 R180H possibly damaging Het
Pkd1l1 A T 11: 8,962,701 V168E probably damaging Het
Prokr2 T A 2: 132,381,175 D149V probably damaging Het
Rnf123 A G 9: 108,063,521 V707A probably benign Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Scarf1 T C 11: 75,515,291 F134L probably damaging Het
Sfxn5 A G 6: 85,332,278 probably null Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Snapc1 A G 12: 73,964,643 T28A probably benign Het
Soat1 T C 1: 156,431,099 Y528C probably damaging Het
Spem1 G A 11: 69,821,518 R107C possibly damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Sycp2 A T 2: 178,374,595 N691K probably damaging Het
Syne2 A T 12: 76,095,537 I6183F probably damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Tenm3 G A 8: 48,240,270 T1859I probably damaging Het
Thsd7b T A 1: 130,103,072 V1048D probably damaging Het
Tmem55b C G 14: 50,930,292 V59L probably damaging Het
Ttc37 A G 13: 76,182,867 E1472G probably damaging Het
Vav3 T C 3: 109,341,166 L43P probably damaging Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Xirp2 A T 2: 67,524,992 T3366S probably benign Het
Zbtb49 A C 5: 38,203,357 probably benign Het
Other mutations in Wwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Wwp2 APN 8 107533291 critical splice donor site probably null
IGL01411:Wwp2 APN 8 107506345 missense probably benign 0.07
IGL01503:Wwp2 APN 8 107549781 missense probably damaging 0.97
IGL01543:Wwp2 APN 8 107483368 missense probably damaging 1.00
IGL01998:Wwp2 APN 8 107549521 missense probably damaging 1.00
IGL02020:Wwp2 APN 8 107556495 missense probably damaging 1.00
IGL02089:Wwp2 APN 8 107554057 missense probably damaging 1.00
IGL02131:Wwp2 APN 8 107552318 missense probably damaging 0.99
IGL02352:Wwp2 APN 8 107540646 nonsense probably null
IGL02359:Wwp2 APN 8 107540646 nonsense probably null
IGL02419:Wwp2 APN 8 107549815 missense probably damaging 1.00
IGL02528:Wwp2 APN 8 107554467 missense probably benign 0.06
R0639:Wwp2 UTSW 8 107517946 missense probably benign 0.01
R0834:Wwp2 UTSW 8 107556796 splice site probably benign
R1573:Wwp2 UTSW 8 107548489 missense probably damaging 1.00
R1653:Wwp2 UTSW 8 107483410 missense possibly damaging 0.49
R1782:Wwp2 UTSW 8 107506399 frame shift probably null
R1941:Wwp2 UTSW 8 107517915 missense probably benign
R4014:Wwp2 UTSW 8 107485621 missense probably benign 0.03
R4118:Wwp2 UTSW 8 107545459 missense probably benign 0.00
R4402:Wwp2 UTSW 8 107457978 missense probably benign 0.08
R5042:Wwp2 UTSW 8 107548485 missense possibly damaging 0.95
R5117:Wwp2 UTSW 8 107554062 missense possibly damaging 0.86
R5413:Wwp2 UTSW 8 107555078 missense probably damaging 1.00
R6175:Wwp2 UTSW 8 107483407 missense possibly damaging 0.95
R6232:Wwp2 UTSW 8 107506345 missense probably benign 0.03
R6323:Wwp2 UTSW 8 107540671 missense probably damaging 1.00
R6759:Wwp2 UTSW 8 107540682 missense probably damaging 1.00
R6941:Wwp2 UTSW 8 107548502 missense probably damaging 1.00
R7043:Wwp2 UTSW 8 107457900 missense probably benign 0.00
R7109:Wwp2 UTSW 8 107483356 missense probably benign 0.28
R7457:Wwp2 UTSW 8 107517960 missense probably benign 0.05
R8027:Wwp2 UTSW 8 107555477 missense probably damaging 1.00
X0066:Wwp2 UTSW 8 107518023 missense probably benign
Z1088:Wwp2 UTSW 8 107555087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCAAGTGTGAGTGGGC -3'
(R):5'- ACCTTCTTGTGTCCTGAGGC -3'

Sequencing Primer
(F):5'- ACCTAACCTTCTGTAGCAGGTTGG -3'
(R):5'- AGGCTCTTGAGGTATTAAGCAC -3'
Posted On2014-12-04