Mutagenetix > Incidental Mutations

Incidental Mutation 'R2483:Col6a5'

250674

Institutional Source

Beutler Lab

Gene Symbol

Col6a5

Ensembl Gene

ENSMUSG00000091345

Gene Name

collagen, type VI, alpha 5

Synonyms

Gm7455, Col6a5

MMRRC Submission

040407-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.821) question?

Stock #

R2483 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105856078-105960643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 105864148 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Isoleucine at position 2524 (R2524I)

Ref Sequence

ENSEMBL: ENSMUSP00000139398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]

Predicted Effect

probably damaging
Transcript: ENSMUST00000165165
AA Change: R2524I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345
AA Change: R2524I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
VWA	28	200	1.8e-24	SMART
low complexity region	222	248	N/A	INTRINSIC
VWA	266	439	2.23e-20	SMART
VWA	472	649	6.84e-39	SMART
VWA	658	834	1.52e-45	SMART
VWA	844	1024	2.44e-44	SMART
VWA	1035	1208	2.95e-20	SMART
Pfam:Collagen	1425	1478	3.3e-8	PFAM
low complexity region	1493	1508	N/A	INTRINSIC
low complexity region	1535	1552	N/A	INTRINSIC
Pfam:Collagen	1555	1616	9.6e-10	PFAM
low complexity region	1711	1730	N/A	INTRINSIC
low complexity region	1739	1757	N/A	INTRINSIC
VWA	1788	1964	1.99e-17	SMART
VWA	1994	2173	5.98e-21	SMART
VWA	2319	2513	4.4e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000190193
AA Change: R2524I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: R2524I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
VWA	28	200	1.1e-26	SMART
low complexity region	222	248	N/A	INTRINSIC
VWA	266	439	1.4e-22	SMART
VWA	472	649	4.4e-41	SMART
VWA	658	834	9.5e-48	SMART
VWA	844	1024	1.6e-46	SMART
VWA	1035	1208	1.9e-22	SMART
Pfam:Collagen	1425	1478	1.2e-6	PFAM
Pfam:Collagen	1457	1530	5.9e-6	PFAM
low complexity region	1535	1552	N/A	INTRINSIC
Pfam:Collagen	1555	1616	3.6e-8	PFAM
Pfam:Collagen	1631	1691	8.4e-6	PFAM
Pfam:Collagen	1706	1764	6.6e-6	PFAM
VWA	1788	1964	1.2e-19	SMART
VWA	1994	2173	3.7e-23	SMART
VWA	2319	2513	2.8e-21	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230050P20Rik	A	T	9: 20,873,177	I186F	possibly damaging	Het
Adcy1	A	G	11: 7,130,348	T364A	probably benign	Het
Adpgk	G	A	9: 59,313,753	V281I	probably benign	Het
Akap9	C	A	5: 3,976,235	Q1297K	possibly damaging	Het
Ankrd13d	T	C	19: 4,281,940	E110G	probably damaging	Het
Ankrd53	A	G	6: 83,763,262	E104G	possibly damaging	Het
Ano6	A	T	15: 95,965,974	T792S	probably benign	Het
Atm	A	T	9: 53,510,266	V715D	probably damaging	Het
Avl9	A	G	6: 56,736,843	D362G	probably benign	Het
Bin1	T	A	18: 32,414,227	S152R	probably damaging	Het
Bscl2	T	A	19: 8,841,150	C40S	probably benign	Het
Btaf1	A	G	19: 36,981,086	T668A	probably benign	Het
Btrc	A	G	19: 45,516,058	D397G	probably damaging	Het
C530008M17Rik	A	T	5: 76,856,409	I206F	probably damaging	Het
Cables2	A	T	2: 180,260,429	V379E	probably damaging	Het
Cacna2d2	T	C	9: 107,512,022	L228P	probably damaging	Het
Cd109	A	T	9: 78,667,357	D541V	probably damaging	Het
Cdh26	A	T	2: 178,466,589	S327C	probably damaging	Het
Cep78	T	C	19: 15,960,980	K535E	probably damaging	Het
Ces1a	A	G	8: 93,027,341	Y345H	probably damaging	Het
Dctn1	G	A	6: 83,194,187	R661H	probably damaging	Het
Ddias	T	C	7: 92,859,592	T372A	probably benign	Het
Dffb	T	C	4: 153,965,519	T296A	probably damaging	Het
Dock8	A	G	19: 25,079,877	Q216R	probably benign	Het
Emx1	T	C	6: 85,188,255	S105P	probably benign	Het
Ep400	T	C	5: 110,719,236	Y1014C	unknown	Het
Fam193a	A	T	5: 34,465,758	K1230M	possibly damaging	Het
Fgf9	A	G	14: 58,109,571	Q207R	probably benign	Het
Gm5460	G	A	14: 34,045,818	C461Y	possibly damaging	Het
Gpc1	T	C	1: 92,855,938	I249T	probably benign	Het
Htr1d	T	C	4: 136,443,504	I348T	probably damaging	Het
Hyal4	A	T	6: 24,765,738	S364C	probably damaging	Het
Igfn1	T	C	1: 135,969,537	E1097G	probably benign	Het
Igkv1-133	A	T	6: 67,724,960	Q16L	probably benign	Het
Kcnh5	A	T	12: 75,114,471	I221N	probably damaging	Het
Kmt2a	A	G	9: 44,848,966	Y529H	probably damaging	Het
Kyat1	T	C	2: 30,186,698	H218R	possibly damaging	Het
Lamb2	T	G	9: 108,480,559	C94G	probably damaging	Het
Met	A	T	6: 17,549,086	D979V	probably damaging	Het
Midn	A	G	10: 80,150,310	D78G	probably benign	Het
Myh1	A	T	11: 67,211,226	M811L	probably benign	Het
Myh7	T	C	14: 54,973,381	E1693G	probably damaging	Het
Myo15b	A	G	11: 115,864,739	T979A	probably benign	Het
Myo18b	A	T	5: 112,858,408	C879S	probably damaging	Het
Myom1	A	G	17: 71,077,812	T733A	probably damaging	Het
Ndufa9	A	T	6: 126,844,399	M76K	possibly damaging	Het
Nectin3	A	G	16: 46,395,179	C74R	possibly damaging	Het
Obscn	A	G	11: 59,080,146	F2514L	probably damaging	Het
Olfr1241	G	A	2: 89,483,127	Q3*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr653	T	C	7: 104,579,942	S99P	probably damaging	Het
P2ry2	A	T	7: 100,998,499	S200T	probably benign	Het
Pcdha5	G	T	18: 36,961,489	M350I	probably benign	Het
Pcdha5	G	A	18: 36,961,781	V448M	probably damaging	Het
Pex12	C	T	11: 83,297,629	R180H	possibly damaging	Het
Pkd1l1	A	T	11: 8,962,701	V168E	probably damaging	Het
Prokr2	T	A	2: 132,381,175	D149V	probably damaging	Het
Rnf123	A	G	9: 108,063,521	V707A	probably benign	Het
Ryr2	T	C	13: 11,759,703	E1189G	probably damaging	Het
Scarf1	T	C	11: 75,515,291	F134L	probably damaging	Het
Sfxn5	A	G	6: 85,332,278		probably null	Het
Slc17a5	A	T	9: 78,538,274	V433D	probably damaging	Het
Snapc1	A	G	12: 73,964,643	T28A	probably benign	Het
Soat1	T	C	1: 156,431,099	Y528C	probably damaging	Het
Spem1	G	A	11: 69,821,518	R107C	possibly damaging	Het
Srcap	T	C	7: 127,542,147	S1639P	probably damaging	Het
Sycp2	A	T	2: 178,374,595	N691K	probably damaging	Het
Syne2	A	T	12: 76,095,537	I6183F	probably damaging	Het
Tas2r110	A	T	6: 132,868,470	M155L	probably benign	Het
Tenm3	G	A	8: 48,240,270	T1859I	probably damaging	Het
Thsd7b	T	A	1: 130,103,072	V1048D	probably damaging	Het
Tmem55b	C	G	14: 50,930,292	V59L	probably damaging	Het
Ttc37	A	G	13: 76,182,867	E1472G	probably damaging	Het
Vav3	T	C	3: 109,341,166	L43P	probably damaging	Het
Vmn1r30	A	T	6: 58,435,452	F132I	probably benign	Het
Vmn2r24	A	G	6: 123,816,038	R775G	probably damaging	Het
Vps13c	T	A	9: 67,975,907		probably null	Het
Vps37c	T	A	19: 10,706,205		probably null	Het
Wwp2	A	G	8: 107,548,535	D388G	probably damaging	Het
Xirp2	A	T	2: 67,524,992	T3366S	probably benign	Het
Zbtb49	A	C	5: 38,203,357		probably benign	Het

Other mutations in Col6a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Col6a5	APN	9	105882683	missense	probably damaging	1.00
IGL01462:Col6a5	APN	9	105946075	missense	unknown
IGL01530:Col6a5	APN	9	105915186	splice site	probably benign
IGL01717:Col6a5	APN	9	105940273	missense	unknown
IGL01859:Col6a5	APN	9	105930961	nonsense	probably null
IGL01945:Col6a5	APN	9	105928290	missense	unknown
IGL01985:Col6a5	APN	9	105937283	missense	unknown
IGL02128:Col6a5	APN	9	105939894	missense	unknown
IGL02170:Col6a5	APN	9	105928422	missense	unknown
IGL02224:Col6a5	APN	9	105864335	missense	probably damaging	1.00
IGL02246:Col6a5	APN	9	105911107	nonsense	probably null
IGL02304:Col6a5	APN	9	105928414	missense	unknown
IGL02338:Col6a5	APN	9	105878630	missense	probably damaging	1.00
IGL02375:Col6a5	APN	9	105906113	missense	unknown
IGL02660:Col6a5	APN	9	105936886	missense	unknown
IGL02829:Col6a5	APN	9	105934307	missense	unknown
IGL02882:Col6a5	APN	9	105934321	missense	unknown
IGL02973:Col6a5	APN	9	105925821	missense	unknown
IGL03089:Col6a5	APN	9	105933839	missense	unknown
IGL03100:Col6a5	APN	9	105937313	missense	unknown
IGL03257:Col6a5	APN	9	105881873	missense	possibly damaging	0.95
FR4340:Col6a5	UTSW	9	105934174	missense	unknown
FR4342:Col6a5	UTSW	9	105934174	missense	unknown
FR4589:Col6a5	UTSW	9	105934174	missense	unknown
PIT4131001:Col6a5	UTSW	9	105881914	missense	probably damaging	0.98
R0147:Col6a5	UTSW	9	105925794	missense	unknown
R0549:Col6a5	UTSW	9	105904579	splice site	probably benign
R0622:Col6a5	UTSW	9	105925852	missense	unknown
R0628:Col6a5	UTSW	9	105912450	splice site	probably null
R0635:Col6a5	UTSW	9	105928606	missense	unknown
R0644:Col6a5	UTSW	9	105948324	critical splice donor site	probably null
R0828:Col6a5	UTSW	9	105862064	critical splice acceptor site	probably null
R0972:Col6a5	UTSW	9	105940285	missense	unknown
R1065:Col6a5	UTSW	9	105881783	missense	probably damaging	0.99
R1142:Col6a5	UTSW	9	105934317	missense	unknown
R1169:Col6a5	UTSW	9	105896974	splice site	probably null
R1522:Col6a5	UTSW	9	105939994	missense	unknown
R1646:Col6a5	UTSW	9	105862749	nonsense	probably null
R1719:Col6a5	UTSW	9	105931293	missense	unknown
R1759:Col6a5	UTSW	9	105930846	missense	unknown
R1780:Col6a5	UTSW	9	105936878	missense	unknown
R1812:Col6a5	UTSW	9	105928054	missense	unknown
R1838:Col6a5	UTSW	9	105864833	missense	probably benign	0.28
R1839:Col6a5	UTSW	9	105864833	missense	probably benign	0.28
R1863:Col6a5	UTSW	9	105940201	missense	unknown
R1900:Col6a5	UTSW	9	105931213	missense	unknown
R1951:Col6a5	UTSW	9	105936957	missense	unknown
R2024:Col6a5	UTSW	9	105936994	missense	unknown
R2126:Col6a5	UTSW	9	105945600	missense	unknown
R2319:Col6a5	UTSW	9	105937218	missense	unknown
R2344:Col6a5	UTSW	9	105928537	missense	unknown
R3176:Col6a5	UTSW	9	105911107	nonsense	probably null
R3276:Col6a5	UTSW	9	105911107	nonsense	probably null
R3438:Col6a5	UTSW	9	105875792	missense	possibly damaging	0.88
R3791:Col6a5	UTSW	9	105864669	missense	probably damaging	0.99
R3840:Col6a5	UTSW	9	105928611	missense	unknown
R3886:Col6a5	UTSW	9	105930930	missense	unknown
R3941:Col6a5	UTSW	9	105939834	missense	unknown
R4194:Col6a5	UTSW	9	105945914	missense	unknown
R4399:Col6a5	UTSW	9	105888965	missense	possibly damaging	0.75
R4421:Col6a5	UTSW	9	105928473	missense	unknown
R4450:Col6a5	UTSW	9	105904521	missense	unknown
R4491:Col6a5	UTSW	9	105940012	missense	unknown
R4582:Col6a5	UTSW	9	105862764	missense	probably benign	0.17
R4693:Col6a5	UTSW	9	105937172	missense	unknown
R4787:Col6a5	UTSW	9	105931081	missense	unknown
R4789:Col6a5	UTSW	9	105937335	missense	unknown
R4791:Col6a5	UTSW	9	105930784	missense	unknown
R4792:Col6a5	UTSW	9	105930784	missense	unknown
R4817:Col6a5	UTSW	9	105934298	missense	unknown
R4854:Col6a5	UTSW	9	105898751	missense	probably benign	0.18
R4927:Col6a5	UTSW	9	105933964	missense	unknown
R4969:Col6a5	UTSW	9	105864607	missense	probably damaging	1.00
R5037:Col6a5	UTSW	9	105928138	missense	unknown
R5118:Col6a5	UTSW	9	105937005	missense	unknown
R5144:Col6a5	UTSW	9	105889283	missense	probably damaging	1.00
R5145:Col6a5	UTSW	9	105934245	missense	unknown
R5160:Col6a5	UTSW	9	105931009	missense	unknown
R5182:Col6a5	UTSW	9	105857332	nonsense	probably null
R5234:Col6a5	UTSW	9	105864205	missense	probably damaging	1.00
R5252:Col6a5	UTSW	9	105940290	missense	unknown
R5290:Col6a5	UTSW	9	105946083	missense	unknown
R5313:Col6a5	UTSW	9	105945544	missense	unknown
R5321:Col6a5	UTSW	9	105928465	missense	unknown
R5466:Col6a5	UTSW	9	105931083	missense	unknown
R5540:Col6a5	UTSW	9	105862776	missense	probably benign	0.44
R5669:Col6a5	UTSW	9	105925998	missense	unknown
R5789:Col6a5	UTSW	9	105864608	missense	possibly damaging	0.91
R5801:Col6a5	UTSW	9	105948367	missense	unknown
R5827:Col6a5	UTSW	9	105928120	nonsense	probably null
R5839:Col6a5	UTSW	9	105945393	critical splice donor site	probably null
R5908:Col6a5	UTSW	9	105862801	missense	possibly damaging	0.88
R5970:Col6a5	UTSW	9	105945847	missense	unknown
R6045:Col6a5	UTSW	9	105925918	missense	unknown
R6107:Col6a5	UTSW	9	105892272	nonsense	probably null
R6168:Col6a5	UTSW	9	105875787	critical splice donor site	probably null
R6315:Col6a5	UTSW	9	105881970	missense	probably damaging	1.00
R6317:Col6a5	UTSW	9	105889067	missense	probably damaging	1.00
R6414:Col6a5	UTSW	9	105892266	splice site	probably null
R6434:Col6a5	UTSW	9	105937345	missense	unknown
R6456:Col6a5	UTSW	9	105945477	missense	unknown
R6698:Col6a5	UTSW	9	105934175	missense	unknown
R6876:Col6a5	UTSW	9	105937307	missense	unknown
R6882:Col6a5	UTSW	9	105940270	nonsense	probably null
R6928:Col6a5	UTSW	9	105939919	missense	unknown
R7024:Col6a5	UTSW	9	105912475	nonsense	probably null
R7038:Col6a5	UTSW	9	105945738	missense	unknown
R7082:Col6a5	UTSW	9	105931239	missense	unknown
R7158:Col6a5	UTSW	9	105864208	missense	possibly damaging	0.90
R7211:Col6a5	UTSW	9	105928164	missense	unknown
R7431:Col6a5	UTSW	9	105928269	missense	unknown
R7440:Col6a5	UTSW	9	105881431	nonsense	probably null
R7502:Col6a5	UTSW	9	105875876	missense	probably benign	0.05
R7577:Col6a5	UTSW	9	105864688	nonsense	probably null
R7582:Col6a5	UTSW	9	105945426	missense	unknown
R7641:Col6a5	UTSW	9	105881426	nonsense	probably null
R7762:Col6a5	UTSW	9	105931324	missense	unknown
R7793:Col6a5	UTSW	9	105898735	missense	probably damaging	1.00
R7821:Col6a5	UTSW	9	105864259	missense	probably damaging	1.00
R7848:Col6a5	UTSW	9	105928186	missense	unknown
R7897:Col6a5	UTSW	9	105889183	missense	possibly damaging	0.96
R7904:Col6a5	UTSW	9	105928521	missense	unknown
R7960:Col6a5	UTSW	9	105945850	missense	unknown
R8015:Col6a5	UTSW	9	105881741	missense	possibly damaging	0.65
R8100:Col6a5	UTSW	9	105878640	missense	probably damaging	1.00
R8131:Col6a5	UTSW	9	105901616	missense	unknown
R8418:Col6a5	UTSW	9	105878622	missense	probably damaging	1.00
R8425:Col6a5	UTSW	9	105945957	missense	unknown
R8678:Col6a5	UTSW	9	105934352	missense	unknown
R8690:Col6a5	UTSW	9	105882597	missense	probably damaging	0.97
RF013:Col6a5	UTSW	9	105878597	frame shift	probably null
X0054:Col6a5	UTSW	9	105915158	missense	unknown
X0058:Col6a5	UTSW	9	105881778	nonsense	probably null
Z1088:Col6a5	UTSW	9	105926067	missense	unknown
Z1177:Col6a5	UTSW	9	105930785	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGCAAATGTTCAGAAGTCAGGC -3'
(R):5'- GTGCCAAGGCTACTCCATATTTG -3'

Sequencing Primer
(F):5'- AGGATCTCCTGCCTAGAACTG -3'
(R):5'- AAGGCTACTCCATATTTGTATTTTCC -3'

Posted On

2014-12-04