Incidental Mutation 'R2483:Rnf123'
ID 250676
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 040407-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R2483 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 107928869-107957183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107940720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 707 (V707A)
Ref Sequence ENSEMBL: ENSMUSP00000136953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000047746
AA Change: V713A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: V713A

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160249
AA Change: V707A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: V707A

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: V707A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: V707A

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000162355
AA Change: V713A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: V713A

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Predicted Effect probably benign
Transcript: ENSMUST00000178267
AA Change: V707A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: V707A

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173683
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,080,348 (GRCm39) T364A probably benign Het
Adpgk G A 9: 59,221,036 (GRCm39) V281I probably benign Het
Akap9 C A 5: 4,026,235 (GRCm39) Q1297K possibly damaging Het
Ankrd13d T C 19: 4,331,968 (GRCm39) E110G probably damaging Het
Ankrd53 A G 6: 83,740,244 (GRCm39) E104G possibly damaging Het
Ano6 A T 15: 95,863,855 (GRCm39) T792S probably benign Het
Atm A T 9: 53,421,566 (GRCm39) V715D probably damaging Het
Avl9 A G 6: 56,713,828 (GRCm39) D362G probably benign Het
Bin1 T A 18: 32,547,280 (GRCm39) S152R probably damaging Het
Bscl2 T A 19: 8,818,514 (GRCm39) C40S probably benign Het
Btaf1 A G 19: 36,958,486 (GRCm39) T668A probably benign Het
Btrc A G 19: 45,504,497 (GRCm39) D397G probably damaging Het
Cables2 A T 2: 179,902,222 (GRCm39) V379E probably damaging Het
Cacna2d2 T C 9: 107,389,221 (GRCm39) L228P probably damaging Het
Cd109 A T 9: 78,574,639 (GRCm39) D541V probably damaging Het
Cdh26 A T 2: 178,108,382 (GRCm39) S327C probably damaging Het
Cep78 T C 19: 15,938,344 (GRCm39) K535E probably damaging Het
Ces1a A G 8: 93,753,969 (GRCm39) Y345H probably damaging Het
Col6a5 C A 9: 105,741,347 (GRCm39) R2524I probably damaging Het
Cracd A T 5: 77,004,256 (GRCm39) I206F probably damaging Het
Dctn1 G A 6: 83,171,169 (GRCm39) R661H probably damaging Het
Ddias T C 7: 92,508,800 (GRCm39) T372A probably benign Het
Dffb T C 4: 154,049,976 (GRCm39) T296A probably damaging Het
Dock8 A G 19: 25,057,241 (GRCm39) Q216R probably benign Het
Emx1 T C 6: 85,165,237 (GRCm39) S105P probably benign Het
Ep400 T C 5: 110,867,102 (GRCm39) Y1014C unknown Het
Fam193a A T 5: 34,623,102 (GRCm39) K1230M possibly damaging Het
Fgf9 A G 14: 58,347,028 (GRCm39) Q207R probably benign Het
Gm5460 G A 14: 33,767,775 (GRCm39) C461Y possibly damaging Het
Gpc1 T C 1: 92,783,660 (GRCm39) I249T probably benign Het
Htr1d T C 4: 136,170,815 (GRCm39) I348T probably damaging Het
Hyal4 A T 6: 24,765,737 (GRCm39) S364C probably damaging Het
Igfn1 T C 1: 135,897,275 (GRCm39) E1097G probably benign Het
Igkv1-133 A T 6: 67,701,944 (GRCm39) Q16L probably benign Het
Kcnh5 A T 12: 75,161,245 (GRCm39) I221N probably damaging Het
Kmt2a A G 9: 44,760,263 (GRCm39) Y529H probably damaging Het
Kyat1 T C 2: 30,076,710 (GRCm39) H218R possibly damaging Het
Lamb2 T G 9: 108,357,758 (GRCm39) C94G probably damaging Het
Met A T 6: 17,549,085 (GRCm39) D979V probably damaging Het
Midn A G 10: 79,986,144 (GRCm39) D78G probably benign Het
Myh1 A T 11: 67,102,052 (GRCm39) M811L probably benign Het
Myh7 T C 14: 55,210,838 (GRCm39) E1693G probably damaging Het
Myo15b A G 11: 115,755,565 (GRCm39) T979A probably benign Het
Myo18b A T 5: 113,006,274 (GRCm39) C879S probably damaging Het
Myom1 A G 17: 71,384,807 (GRCm39) T733A probably damaging Het
Ndufa9 A T 6: 126,821,362 (GRCm39) M76K possibly damaging Het
Nectin3 A G 16: 46,215,542 (GRCm39) C74R possibly damaging Het
Obscn A G 11: 58,970,972 (GRCm39) F2514L probably damaging Het
Or4a69 G A 2: 89,313,471 (GRCm39) Q3* probably null Het
Or52d3 T C 7: 104,229,149 (GRCm39) S99P probably damaging Het
Or5p81 CAAATA CA 7: 108,266,869 (GRCm39) probably null Het
P2ry2 A T 7: 100,647,706 (GRCm39) S200T probably benign Het
Pcdha5 G T 18: 37,094,542 (GRCm39) M350I probably benign Het
Pcdha5 G A 18: 37,094,834 (GRCm39) V448M probably damaging Het
Pex12 C T 11: 83,188,455 (GRCm39) R180H possibly damaging Het
Pip4p1 C G 14: 51,167,749 (GRCm39) V59L probably damaging Het
Pkd1l1 A T 11: 8,912,701 (GRCm39) V168E probably damaging Het
Prokr2 T A 2: 132,223,095 (GRCm39) D149V probably damaging Het
Ryr2 T C 13: 11,774,589 (GRCm39) E1189G probably damaging Het
Scarf1 T C 11: 75,406,117 (GRCm39) F134L probably damaging Het
Sfxn5 A G 6: 85,309,260 (GRCm39) probably null Het
Shfl A T 9: 20,784,473 (GRCm39) I186F possibly damaging Het
Skic3 A G 13: 76,330,986 (GRCm39) E1472G probably damaging Het
Slc17a5 A T 9: 78,445,556 (GRCm39) V433D probably damaging Het
Snapc1 A G 12: 74,011,417 (GRCm39) T28A probably benign Het
Soat1 T C 1: 156,258,669 (GRCm39) Y528C probably damaging Het
Spem1 G A 11: 69,712,344 (GRCm39) R107C possibly damaging Het
Srcap T C 7: 127,141,319 (GRCm39) S1639P probably damaging Het
Sycp2 A T 2: 178,016,388 (GRCm39) N691K probably damaging Het
Syne2 A T 12: 76,142,311 (GRCm39) I6183F probably damaging Het
Tas2r110 A T 6: 132,845,433 (GRCm39) M155L probably benign Het
Tenm3 G A 8: 48,693,305 (GRCm39) T1859I probably damaging Het
Thsd7b T A 1: 130,030,809 (GRCm39) V1048D probably damaging Het
Vav3 T C 3: 109,248,482 (GRCm39) L43P probably damaging Het
Vmn1r30 A T 6: 58,412,437 (GRCm39) F132I probably benign Het
Vmn2r24 A G 6: 123,792,997 (GRCm39) R775G probably damaging Het
Vps13c T A 9: 67,883,189 (GRCm39) probably null Het
Vps37c T A 19: 10,683,569 (GRCm39) probably null Het
Wwp2 A G 8: 108,275,167 (GRCm39) D388G probably damaging Het
Xirp2 A T 2: 67,355,336 (GRCm39) T3366S probably benign Het
Zbtb49 A C 5: 38,360,701 (GRCm39) probably benign Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 107,944,594 (GRCm39) critical splice donor site probably null
IGL01358:Rnf123 APN 9 107,946,381 (GRCm39) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 107,929,501 (GRCm39) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 107,935,437 (GRCm39) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 107,935,555 (GRCm39) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 107,948,569 (GRCm39) splice site probably benign
IGL02070:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02072:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02073:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02074:Rnf123 APN 9 107,944,088 (GRCm39) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02080:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02231:Rnf123 APN 9 107,943,598 (GRCm39) missense probably benign 0.17
IGL02281:Rnf123 APN 9 107,948,651 (GRCm39) missense probably benign 0.01
IGL02336:Rnf123 APN 9 107,939,041 (GRCm39) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 107,943,547 (GRCm39) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 107,929,411 (GRCm39) critical splice donor site probably null
IGL02571:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02572:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02574:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02586:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02589:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02600:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02601:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02602:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02603:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02609:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02628:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02629:Rnf123 APN 9 107,947,988 (GRCm39) splice site probably benign
IGL02629:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02630:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02631:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02632:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02650:Rnf123 APN 9 107,946,947 (GRCm39) missense probably benign 0.29
IGL02690:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02691:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02692:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02693:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02713:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02736:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02929:Rnf123 APN 9 107,946,275 (GRCm39) missense probably benign
R1175:Rnf123 UTSW 9 107,954,572 (GRCm39) missense probably benign
R1465:Rnf123 UTSW 9 107,948,665 (GRCm39) splice site probably benign
R1502:Rnf123 UTSW 9 107,945,709 (GRCm39) splice site probably null
R1682:Rnf123 UTSW 9 107,954,597 (GRCm39) missense probably benign 0.16
R1817:Rnf123 UTSW 9 107,940,125 (GRCm39) missense probably benign 0.41
R1855:Rnf123 UTSW 9 107,938,990 (GRCm39) missense probably damaging 1.00
R2394:Rnf123 UTSW 9 107,940,735 (GRCm39) missense probably benign 0.00
R3896:Rnf123 UTSW 9 107,946,302 (GRCm39) splice site probably benign
R3940:Rnf123 UTSW 9 107,941,234 (GRCm39) splice site probably benign
R4206:Rnf123 UTSW 9 107,941,162 (GRCm39) missense probably benign 0.01
R4641:Rnf123 UTSW 9 107,935,786 (GRCm39) missense probably damaging 1.00
R4714:Rnf123 UTSW 9 107,929,638 (GRCm39) splice site probably null
R4767:Rnf123 UTSW 9 107,929,288 (GRCm39) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 107,933,290 (GRCm39) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 107,940,879 (GRCm39) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5275:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5276:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5294:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5295:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5394:Rnf123 UTSW 9 107,947,930 (GRCm39) missense probably damaging 1.00
R5717:Rnf123 UTSW 9 107,944,623 (GRCm39) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 107,947,157 (GRCm39) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 107,933,252 (GRCm39) missense probably benign 0.17
R6502:Rnf123 UTSW 9 107,945,531 (GRCm39) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 107,940,822 (GRCm39) missense probably benign 0.02
R7003:Rnf123 UTSW 9 107,940,882 (GRCm39) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 107,935,735 (GRCm39) missense probably null 1.00
R7092:Rnf123 UTSW 9 107,945,799 (GRCm39) missense probably benign 0.07
R7100:Rnf123 UTSW 9 107,933,838 (GRCm39) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 107,946,228 (GRCm39) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 107,947,607 (GRCm39) splice site probably null
R7468:Rnf123 UTSW 9 107,946,208 (GRCm39) missense probably benign 0.00
R7517:Rnf123 UTSW 9 107,947,473 (GRCm39) nonsense probably null
R7577:Rnf123 UTSW 9 107,947,818 (GRCm39) missense probably damaging 1.00
R8296:Rnf123 UTSW 9 107,940,089 (GRCm39) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 107,945,706 (GRCm39) missense probably benign 0.26
R8754:Rnf123 UTSW 9 107,948,363 (GRCm39) missense probably damaging 1.00
R8783:Rnf123 UTSW 9 107,946,272 (GRCm39) missense probably benign
R9052:Rnf123 UTSW 9 107,936,930 (GRCm39) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 107,940,227 (GRCm39) splice site probably benign
R9170:Rnf123 UTSW 9 107,948,375 (GRCm39) missense probably damaging 1.00
R9332:Rnf123 UTSW 9 107,944,704 (GRCm39) missense probably benign 0.00
R9385:Rnf123 UTSW 9 107,929,467 (GRCm39) missense probably benign 0.02
R9394:Rnf123 UTSW 9 107,942,905 (GRCm39) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 107,937,008 (GRCm39) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 107,954,963 (GRCm39) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 107,940,180 (GRCm39) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 107,935,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGACTGTGCTTCCTGTGC -3'
(R):5'- GAGTTCTACATAGGCCCTAGTCTTGG -3'

Sequencing Primer
(F):5'- GCTTCCTGTGCCCTTGGG -3'
(R):5'- CTAGTCTTGGAAGCCAGACTAGC -3'
Posted On 2014-12-04