Mutagenetix > Incidental Mutations

Incidental Mutation 'R2483:Rnf123'

250676

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

040407-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.388) question?

Stock #

R2483 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108063521 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 707 (V707A)

Ref Sequence

ENSEMBL: ENSMUSP00000136953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]

Predicted Effect

probably benign
Transcript: ENSMUST00000047746
AA Change: V713A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: V713A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159136

Predicted Effect

probably benign
Transcript: ENSMUST00000159306

SMART Domains

Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
coiled coil region	172	192	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160249
AA Change: V707A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: V707A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160649
AA Change: V707A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: V707A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160841

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161673

Predicted Effect

probably benign
Transcript: ENSMUST00000162355
AA Change: V713A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: V713A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173683

Predicted Effect

probably benign
Transcript: ENSMUST00000178267
AA Change: V707A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: V707A

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230050P20Rik	A	T	9: 20,873,177	I186F	possibly damaging	Het
Adcy1	A	G	11: 7,130,348	T364A	probably benign	Het
Adpgk	G	A	9: 59,313,753	V281I	probably benign	Het
Akap9	C	A	5: 3,976,235	Q1297K	possibly damaging	Het
Ankrd13d	T	C	19: 4,281,940	E110G	probably damaging	Het
Ankrd53	A	G	6: 83,763,262	E104G	possibly damaging	Het
Ano6	A	T	15: 95,965,974	T792S	probably benign	Het
Atm	A	T	9: 53,510,266	V715D	probably damaging	Het
Avl9	A	G	6: 56,736,843	D362G	probably benign	Het
Bin1	T	A	18: 32,414,227	S152R	probably damaging	Het
Bscl2	T	A	19: 8,841,150	C40S	probably benign	Het
Btaf1	A	G	19: 36,981,086	T668A	probably benign	Het
Btrc	A	G	19: 45,516,058	D397G	probably damaging	Het
C530008M17Rik	A	T	5: 76,856,409	I206F	probably damaging	Het
Cables2	A	T	2: 180,260,429	V379E	probably damaging	Het
Cacna2d2	T	C	9: 107,512,022	L228P	probably damaging	Het
Cd109	A	T	9: 78,667,357	D541V	probably damaging	Het
Cdh26	A	T	2: 178,466,589	S327C	probably damaging	Het
Cep78	T	C	19: 15,960,980	K535E	probably damaging	Het
Ces1a	A	G	8: 93,027,341	Y345H	probably damaging	Het
Col6a5	C	A	9: 105,864,148	R2524I	probably damaging	Het
Dctn1	G	A	6: 83,194,187	R661H	probably damaging	Het
Ddias	T	C	7: 92,859,592	T372A	probably benign	Het
Dffb	T	C	4: 153,965,519	T296A	probably damaging	Het
Dock8	A	G	19: 25,079,877	Q216R	probably benign	Het
Emx1	T	C	6: 85,188,255	S105P	probably benign	Het
Ep400	T	C	5: 110,719,236	Y1014C	unknown	Het
Fam193a	A	T	5: 34,465,758	K1230M	possibly damaging	Het
Fgf9	A	G	14: 58,109,571	Q207R	probably benign	Het
Gm5460	G	A	14: 34,045,818	C461Y	possibly damaging	Het
Gpc1	T	C	1: 92,855,938	I249T	probably benign	Het
Htr1d	T	C	4: 136,443,504	I348T	probably damaging	Het
Hyal4	A	T	6: 24,765,738	S364C	probably damaging	Het
Igfn1	T	C	1: 135,969,537	E1097G	probably benign	Het
Igkv1-133	A	T	6: 67,724,960	Q16L	probably benign	Het
Kcnh5	A	T	12: 75,114,471	I221N	probably damaging	Het
Kmt2a	A	G	9: 44,848,966	Y529H	probably damaging	Het
Kyat1	T	C	2: 30,186,698	H218R	possibly damaging	Het
Lamb2	T	G	9: 108,480,559	C94G	probably damaging	Het
Met	A	T	6: 17,549,086	D979V	probably damaging	Het
Midn	A	G	10: 80,150,310	D78G	probably benign	Het
Myh1	A	T	11: 67,211,226	M811L	probably benign	Het
Myh7	T	C	14: 54,973,381	E1693G	probably damaging	Het
Myo15b	A	G	11: 115,864,739	T979A	probably benign	Het
Myo18b	A	T	5: 112,858,408	C879S	probably damaging	Het
Myom1	A	G	17: 71,077,812	T733A	probably damaging	Het
Ndufa9	A	T	6: 126,844,399	M76K	possibly damaging	Het
Nectin3	A	G	16: 46,395,179	C74R	possibly damaging	Het
Obscn	A	G	11: 59,080,146	F2514L	probably damaging	Het
Olfr1241	G	A	2: 89,483,127	Q3*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr653	T	C	7: 104,579,942	S99P	probably damaging	Het
P2ry2	A	T	7: 100,998,499	S200T	probably benign	Het
Pcdha5	G	T	18: 36,961,489	M350I	probably benign	Het
Pcdha5	G	A	18: 36,961,781	V448M	probably damaging	Het
Pex12	C	T	11: 83,297,629	R180H	possibly damaging	Het
Pkd1l1	A	T	11: 8,962,701	V168E	probably damaging	Het
Prokr2	T	A	2: 132,381,175	D149V	probably damaging	Het
Ryr2	T	C	13: 11,759,703	E1189G	probably damaging	Het
Scarf1	T	C	11: 75,515,291	F134L	probably damaging	Het
Sfxn5	A	G	6: 85,332,278		probably null	Het
Slc17a5	A	T	9: 78,538,274	V433D	probably damaging	Het
Snapc1	A	G	12: 73,964,643	T28A	probably benign	Het
Soat1	T	C	1: 156,431,099	Y528C	probably damaging	Het
Spem1	G	A	11: 69,821,518	R107C	possibly damaging	Het
Srcap	T	C	7: 127,542,147	S1639P	probably damaging	Het
Sycp2	A	T	2: 178,374,595	N691K	probably damaging	Het
Syne2	A	T	12: 76,095,537	I6183F	probably damaging	Het
Tas2r110	A	T	6: 132,868,470	M155L	probably benign	Het
Tenm3	G	A	8: 48,240,270	T1859I	probably damaging	Het
Thsd7b	T	A	1: 130,103,072	V1048D	probably damaging	Het
Tmem55b	C	G	14: 50,930,292	V59L	probably damaging	Het
Ttc37	A	G	13: 76,182,867	E1472G	probably damaging	Het
Vav3	T	C	3: 109,341,166	L43P	probably damaging	Het
Vmn1r30	A	T	6: 58,435,452	F132I	probably benign	Het
Vmn2r24	A	G	6: 123,816,038	R775G	probably damaging	Het
Vps13c	T	A	9: 67,975,907		probably null	Het
Vps37c	T	A	19: 10,706,205		probably null	Het
Wwp2	A	G	8: 107,548,535	D388G	probably damaging	Het
Xirp2	A	T	2: 67,524,992	T3366S	probably benign	Het
Zbtb49	A	C	5: 38,203,357		probably benign	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	unclassified	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R1855:Rnf123	UTSW	9	108061791	missense	probably damaging	1.00
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	intron	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGACTGTGCTTCCTGTGC -3'
(R):5'- GAGTTCTACATAGGCCCTAGTCTTGG -3'

Sequencing Primer
(F):5'- GCTTCCTGTGCCCTTGGG -3'
(R):5'- CTAGTCTTGGAAGCCAGACTAGC -3'

Posted On

2014-12-04