Incidental Mutation 'R2679:Nrp2'
ID250685
Institutional Source Beutler Lab
Gene Symbol Nrp2
Ensembl Gene ENSMUSG00000025969
Gene Nameneuropilin 2
SynonymsNpn2, NP-2, NP2, Npn-2, 1110048P06Rik
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R2679 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location62703285-62818695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62785078 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 781 (S781P)
Ref Sequence ENSEMBL: ENSMUSP00000109794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027112] [ENSMUST00000063594] [ENSMUST00000075144] [ENSMUST00000102822] [ENSMUST00000114155] [ENSMUST00000114157]
Predicted Effect probably benign
Transcript: ENSMUST00000027112
AA Change: S781P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027112
Gene: ENSMUSG00000025969
AA Change: S781P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 1.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063594
AA Change: S781P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000069379
Gene: ENSMUSG00000025969
AA Change: S781P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 816 831 N/A INTRINSIC
Pfam:DUF3481 839 923 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075144
AA Change: S781P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000074642
Gene: ENSMUSG00000025969
AA Change: S781P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 827 911 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102822
AA Change: S781P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099886
Gene: ENSMUSG00000025969
AA Change: S781P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114155
AA Change: S781P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109792
Gene: ENSMUSG00000025969
AA Change: S781P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 817 901 9.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114157
AA Change: S781P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109794
Gene: ENSMUSG00000025969
AA Change: S781P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 821 836 N/A INTRINSIC
Pfam:DUF3481 844 928 2.4e-25 PFAM
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit pre- or postnatal lethality, reduced fertility, hydrocephalus, aberrant sensory innervation, reduced interneuron count, seizure susceptibility and abnormal lymphangiogenesis. Homozygotes for a gene trap allele show abnormal neuronal development and axonal trajectories. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Nrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Nrp2 APN 1 62704251 nonsense probably null
IGL01912:Nrp2 APN 1 62771737 missense probably damaging 1.00
IGL01996:Nrp2 APN 1 62749260 missense probably damaging 1.00
IGL02184:Nrp2 APN 1 62718940 nonsense probably null
IGL02682:Nrp2 APN 1 62771837 missense probably benign 0.03
IGL02928:Nrp2 APN 1 62815446 missense probably damaging 1.00
IGL03024:Nrp2 APN 1 62771734 missense probably damaging 1.00
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0683:Nrp2 UTSW 1 62744318 missense probably benign 0.41
R0789:Nrp2 UTSW 1 62745450 missense probably benign 0.44
R1418:Nrp2 UTSW 1 62783332 nonsense probably null
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1544:Nrp2 UTSW 1 62762904 missense probably damaging 1.00
R1645:Nrp2 UTSW 1 62785124 missense probably damaging 0.97
R1677:Nrp2 UTSW 1 62783320 missense probably benign 0.18
R1752:Nrp2 UTSW 1 62738441 missense probably damaging 1.00
R1840:Nrp2 UTSW 1 62738339 missense probably damaging 1.00
R1916:Nrp2 UTSW 1 62762747 missense probably damaging 1.00
R1962:Nrp2 UTSW 1 62718931 missense probably benign 0.03
R2108:Nrp2 UTSW 1 62744277 missense probably damaging 1.00
R2164:Nrp2 UTSW 1 62744355 missense probably damaging 1.00
R2216:Nrp2 UTSW 1 62762918 nonsense probably null
R4349:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4351:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4352:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4353:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4811:Nrp2 UTSW 1 62719081 missense probably damaging 1.00
R5362:Nrp2 UTSW 1 62769062 missense probably benign 0.01
R5387:Nrp2 UTSW 1 62762813 missense probably benign 0.02
R5461:Nrp2 UTSW 1 62747211 nonsense probably null
R5704:Nrp2 UTSW 1 62785108 missense probably benign 0.00
R6143:Nrp2 UTSW 1 62760815 missense probably damaging 1.00
R6303:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6304:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6376:Nrp2 UTSW 1 62719017 missense possibly damaging 0.65
R6945:Nrp2 UTSW 1 62760788 missense probably damaging 1.00
R7347:Nrp2 UTSW 1 62745504 missense probably benign 0.04
R7393:Nrp2 UTSW 1 62745424 missense probably damaging 0.98
R7593:Nrp2 UTSW 1 62719044 missense probably damaging 0.96
R7881:Nrp2 UTSW 1 62771831 missense probably benign 0.42
R7882:Nrp2 UTSW 1 62783521 missense probably damaging 1.00
R7948:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7964:Nrp2 UTSW 1 62771831 missense probably benign 0.42
R7965:Nrp2 UTSW 1 62783521 missense probably damaging 1.00
R8009:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8012:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8014:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8015:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8068:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8069:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8070:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTATGTTCTTGTTACTGGACAGC -3'
(R):5'- TCACCTCCTGCACAGACTAG -3'

Sequencing Primer
(F):5'- GTTCTTGTTACTGGACAGCAATATC -3'
(R):5'- TCCTGCACAGACTAGCACAG -3'
Posted On2014-12-04