Incidental Mutation 'R2483:Myh1'
ID 250687
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Name myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms A530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
MMRRC Submission 040407-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2483 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 67200052-67224575 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67211226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 811 (M811L)
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000075734] [ENSMUST00000124516]
AlphaFold Q5SX40
Predicted Effect probably benign
Transcript: ENSMUST00000018637
AA Change: M811L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: M811L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075734
AA Change: M811L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: M811L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124516
AA Change: M811L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: M811L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145021
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik A T 9: 20,873,177 I186F possibly damaging Het
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Ano6 A T 15: 95,965,974 T792S probably benign Het
Atm A T 9: 53,510,266 V715D probably damaging Het
Avl9 A G 6: 56,736,843 D362G probably benign Het
Bin1 T A 18: 32,414,227 S152R probably damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Btrc A G 19: 45,516,058 D397G probably damaging Het
C530008M17Rik A T 5: 76,856,409 I206F probably damaging Het
Cables2 A T 2: 180,260,429 V379E probably damaging Het
Cacna2d2 T C 9: 107,512,022 L228P probably damaging Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cdh26 A T 2: 178,466,589 S327C probably damaging Het
Cep78 T C 19: 15,960,980 K535E probably damaging Het
Ces1a A G 8: 93,027,341 Y345H probably damaging Het
Col6a5 C A 9: 105,864,148 R2524I probably damaging Het
Dctn1 G A 6: 83,194,187 R661H probably damaging Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emx1 T C 6: 85,188,255 S105P probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Fam193a A T 5: 34,465,758 K1230M possibly damaging Het
Fgf9 A G 14: 58,109,571 Q207R probably benign Het
Gm5460 G A 14: 34,045,818 C461Y possibly damaging Het
Gpc1 T C 1: 92,855,938 I249T probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igfn1 T C 1: 135,969,537 E1097G probably benign Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Kcnh5 A T 12: 75,114,471 I221N probably damaging Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Kyat1 T C 2: 30,186,698 H218R possibly damaging Het
Lamb2 T G 9: 108,480,559 C94G probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Myo15b A G 11: 115,864,739 T979A probably benign Het
Myo18b A T 5: 112,858,408 C879S probably damaging Het
Myom1 A G 17: 71,077,812 T733A probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nectin3 A G 16: 46,395,179 C74R possibly damaging Het
Obscn A G 11: 59,080,146 F2514L probably damaging Het
Olfr1241 G A 2: 89,483,127 Q3* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcdha5 G T 18: 36,961,489 M350I probably benign Het
Pcdha5 G A 18: 36,961,781 V448M probably damaging Het
Pex12 C T 11: 83,297,629 R180H possibly damaging Het
Pkd1l1 A T 11: 8,962,701 V168E probably damaging Het
Prokr2 T A 2: 132,381,175 D149V probably damaging Het
Rnf123 A G 9: 108,063,521 V707A probably benign Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Scarf1 T C 11: 75,515,291 F134L probably damaging Het
Sfxn5 A G 6: 85,332,278 probably null Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Snapc1 A G 12: 73,964,643 T28A probably benign Het
Soat1 T C 1: 156,431,099 Y528C probably damaging Het
Spem1 G A 11: 69,821,518 R107C possibly damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Sycp2 A T 2: 178,374,595 N691K probably damaging Het
Syne2 A T 12: 76,095,537 I6183F probably damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Tenm3 G A 8: 48,240,270 T1859I probably damaging Het
Thsd7b T A 1: 130,103,072 V1048D probably damaging Het
Tmem55b C G 14: 50,930,292 V59L probably damaging Het
Ttc37 A G 13: 76,182,867 E1472G probably damaging Het
Vav3 T C 3: 109,341,166 L43P probably damaging Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Wwp2 A G 8: 107,548,535 D388G probably damaging Het
Xirp2 A T 2: 67,524,992 T3366S probably benign Het
Zbtb49 A C 5: 38,203,357 probably benign Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
G1patch:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67205925 missense probably benign
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2189:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R3829:Myh1 UTSW 11 67205597 missense probably benign 0.01
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R4981:Myh1 UTSW 11 67224474 utr 3 prime probably benign
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R5870:Myh1 UTSW 11 67201979 missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6813:Myh1 UTSW 11 67220460 missense probably benign 0.34
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7384:Myh1 UTSW 11 67224375 missense possibly damaging 0.46
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7447:Myh1 UTSW 11 67219180 missense probably benign 0.01
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8060:Myh1 UTSW 11 67215251 missense probably benign
R8080:Myh1 UTSW 11 67211402 missense probably benign 0.10
R8117:Myh1 UTSW 11 67222205 missense probably damaging 1.00
R8171:Myh1 UTSW 11 67202572 missense probably damaging 1.00
R8183:Myh1 UTSW 11 67202006 missense possibly damaging 0.50
R8397:Myh1 UTSW 11 67221639 missense probably damaging 0.97
R8545:Myh1 UTSW 11 67202201 missense probably benign 0.00
R8807:Myh1 UTSW 11 67220528 missense probably benign 0.02
R8812:Myh1 UTSW 11 67209141 missense probably benign 0.00
R8855:Myh1 UTSW 11 67211421 missense probably damaging 1.00
R8906:Myh1 UTSW 11 67205913 missense probably benign 0.02
R8959:Myh1 UTSW 11 67211502 missense probably benign
R8992:Myh1 UTSW 11 67205781 missense probably benign
R9140:Myh1 UTSW 11 67209263 missense probably benign 0.04
R9293:Myh1 UTSW 11 67209103 missense probably benign 0.25
R9366:Myh1 UTSW 11 67219288 missense probably damaging 1.00
R9371:Myh1 UTSW 11 67219805 critical splice donor site probably null
R9378:Myh1 UTSW 11 67202433 missense probably damaging 0.99
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Z1187:Myh1 UTSW 11 67204446 missense probably benign
Z1188:Myh1 UTSW 11 67204446 missense probably benign
Z1190:Myh1 UTSW 11 67204446 missense probably benign
Z1191:Myh1 UTSW 11 67204446 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACCAAGGTAATTCCCCTG -3'
(R):5'- GAAATACAGCTTCATCCAGGGCC -3'

Sequencing Primer
(F):5'- ATTCCCCTGAAATCCAGCTTAATG -3'
(R):5'- GGCCAGTGTTTCACATTCATGAAG -3'
Posted On 2014-12-04