Incidental Mutation 'R2679:Nebl'
ID250694
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2679 (G1)
Quality Score223
Status Validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17424591 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 243 (S243N)
Ref Sequence ENSEMBL: ENSMUSP00000118525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000131957] [ENSMUST00000132418] [ENSMUST00000145492]
Predicted Effect probably benign
Transcript: ENSMUST00000028080
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124270
AA Change: S243N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: S243N

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131957
AA Change: S243N

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118525
Gene: ENSMUSG00000053702
AA Change: S243N

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
NEBU 427 457 4.92e-6 SMART
NEBU 464 494 2.33e-7 SMART
NEBU 501 525 1.02e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132418
AA Change: S243N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122024
Gene: ENSMUSG00000053702
AA Change: S243N

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 4.78e-4 SMART
NEBU 427 450 6.81e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145492
AA Change: S243N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000121313
Gene: ENSMUSG00000053702
AA Change: S243N

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
BB008:Nebl UTSW 2 17376622 critical splice donor site probably null
BB018:Nebl UTSW 2 17376622 critical splice donor site probably null
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 splice site probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
R7196:Nebl UTSW 2 17452518 missense probably damaging 1.00
R7671:Nebl UTSW 2 17390916 nonsense probably null
R7728:Nebl UTSW 2 17370514 missense
R7931:Nebl UTSW 2 17376622 critical splice donor site probably null
R8007:Nebl UTSW 2 17370489 missense
R8048:Nebl UTSW 2 17424522 missense probably benign 0.12
R8118:Nebl UTSW 2 17379820 missense possibly damaging 0.48
R8317:Nebl UTSW 2 17350757 missense possibly damaging 0.71
R8349:Nebl UTSW 2 17413782 missense probably damaging 0.98
R8360:Nebl UTSW 2 17460487 missense probably benign 0.04
R8392:Nebl UTSW 2 17452552 missense probably benign 0.36
R8449:Nebl UTSW 2 17413782 missense probably damaging 0.98
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCAGGAAAATATGCTCCAGTG -3'
(R):5'- CTTTATGGAAGGGGATGAATATCAG -3'

Sequencing Primer
(F):5'- CAGGAAAATATGCTCCAGTGTTTTC -3'
(R):5'- GAAAGGTAGCTTTTACTTGATC -3'
Posted On2014-12-04