Mutagenetix > Incidental Mutations

Incidental Mutation 'R2679:Nebl'

250694

Institutional Source

Beutler Lab

Gene Symbol

Nebl

Ensembl Gene

ENSMUSG00000053702

Gene Name

nebulette

Synonyms

Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik

MMRRC Submission

040432-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2679 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

17343909-17731464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 17424591 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 243 (S243N)

Ref Sequence

ENSEMBL: ENSMUSP00000118525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000131957] [ENSMUST00000132418] [ENSMUST00000145492]

Predicted Effect

probably benign
Transcript: ENSMUST00000028080

SMART Domains

Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
LIM	4	56	6.95e-14	SMART
NEBU	62	92	3.35e-8	SMART
NEBU	98	128	4.88e-10	SMART
NEBU	134	164	3.82e-3	SMART
SH3	213	270	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124270
AA Change: S243N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: S243N

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	1.57e0	SMART
NEBU	280	310	9.67e-1	SMART
NEBU	315	345	6.25e-8	SMART
NEBU	351	381	5.97e-5	SMART
NEBU	387	418	2.56e-4	SMART
NEBU	425	455	8.91e-4	SMART
NEBU	462	492	4.92e-6	SMART
NEBU	499	529	2.33e-7	SMART
NEBU	536	566	1.84e-5	SMART
NEBU	571	601	2.23e-4	SMART
NEBU	602	632	1.24e-2	SMART
NEBU	664	694	6.6e-7	SMART
NEBU	695	725	6.86e-5	SMART
NEBU	726	756	2.03e-7	SMART
NEBU	761	791	1.74e-6	SMART
NEBU	797	827	3.82e-3	SMART
SH3	957	1014	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124611

SMART Domains

Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	3	33	4.88e-10	SMART
NEBU	39	69	3.82e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131957
AA Change: S243N

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000118525
Gene: ENSMUSG00000053702
AA Change: S243N

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	7.35e0	SMART
NEBU	280	310	6.25e-8	SMART
NEBU	316	346	5.97e-5	SMART
NEBU	352	383	2.56e-4	SMART
NEBU	390	420	8.91e-4	SMART
NEBU	427	457	4.92e-6	SMART
NEBU	464	494	2.33e-7	SMART
NEBU	501	525	1.02e2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132418
AA Change: S243N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000122024
Gene: ENSMUSG00000053702
AA Change: S243N

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	7.35e0	SMART
NEBU	280	310	6.25e-8	SMART
NEBU	316	346	5.97e-5	SMART
NEBU	352	383	2.56e-4	SMART
NEBU	390	420	4.78e-4	SMART
NEBU	427	450	6.81e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145492
AA Change: S243N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000121313
Gene: ENSMUSG00000053702
AA Change: S243N

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	7.35e0	SMART
NEBU	280	310	6.25e-8	SMART
NEBU	316	346	5.97e-5	SMART
NEBU	352	383	2.56e-4	SMART
NEBU	390	420	8.91e-4	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (67/69)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asic2	A	G	11: 81,151,954	V171A	probably benign	Het
Atf7ip	A	T	6: 136,566,651	I641L	possibly damaging	Het
Atrn	G	A	2: 130,961,675		probably null	Het
Bpifb4	T	C	2: 153,948,624	I145T	probably damaging	Het
Bub3	A	G	7: 131,568,725		probably null	Het
Catsperb	T	A	12: 101,463,145	D192E	probably damaging	Het
Ccdc178	G	A	18: 21,811,556	H849Y	possibly damaging	Het
Cd101	G	T	3: 100,993,763	Q998K	probably benign	Het
Cep135	A	T	5: 76,624,660	M631L	probably benign	Het
Cit	T	C	5: 115,969,115	V1102A	probably benign	Het
Col4a4	G	A	1: 82,529,611	T249M	unknown	Het
Cpne6	A	T	14: 55,516,329	I415F	possibly damaging	Het
Cyp4b1	T	C	4: 115,628,697	I348V	probably benign	Het
Defb28	T	C	2: 152,518,282	S6P	possibly damaging	Het
Dhrs7b	A	G	11: 60,852,518		probably benign	Het
Dhx29	T	C	13: 112,947,376		probably null	Het
Egfem1	A	G	3: 29,670,676	T476A	probably benign	Het
Enpp5	A	G	17: 44,085,388	D397G	probably damaging	Het
Eogt	G	A	6: 97,120,800	T279I	probably benign	Het
Fnip2	G	A	3: 79,480,926	H833Y	probably benign	Het
Gabrr2	A	T	4: 33,071,435	T92S	probably damaging	Het
Gm10110	T	A	14: 89,897,416		noncoding transcript	Het
Gm4778	A	T	3: 94,265,910	Y75F	probably damaging	Het
Gria2	A	G	3: 80,740,953		probably benign	Het
Hmcn1	G	T	1: 150,652,575	T3274N	possibly damaging	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspa1b	T	C	17: 34,957,303	K569E	probably benign	Het
Ighv1-82	T	C	12: 115,952,752	Y46C	probably damaging	Het
Itga3	A	T	11: 95,068,310		probably benign	Het
Lrrc7	T	A	3: 158,175,108	R552*	probably null	Het
Med13	A	G	11: 86,298,577	S1169P	probably benign	Het
Muc4	T	A	16: 32,757,472	D2374E	unknown	Het
Myl9	T	A	2: 156,780,506	L70Q	probably damaging	Het
Nfat5	A	G	8: 107,344,914	Y314C	probably damaging	Het
Nr2f6	T	A	8: 71,374,736	D307V	probably damaging	Het
Nrp2	T	C	1: 62,785,078	S781P	probably benign	Het
Nub1	C	T	5: 24,692,925	T103I	possibly damaging	Het
Olfr32	A	T	2: 90,138,545	V198D	possibly damaging	Het
Olfr572	T	A	7: 102,928,031	Y134*	probably null	Het
Pex5l	A	T	3: 33,082,052	M6K	probably benign	Het
Pgm3	A	C	9: 86,569,321	C93W	probably benign	Het
Pkhd1	A	G	1: 20,209,182	S2971P	probably benign	Het
Pkhd1l1	T	C	15: 44,545,386	L2423P	probably damaging	Het
Prkce	A	G	17: 86,176,226		probably benign	Het
Ptbp3	A	G	4: 59,494,615		probably benign	Het
Ptgis	T	A	2: 167,208,193	M339L	probably benign	Het
Pxdn	T	C	12: 29,975,569		probably benign	Het
Rab44	T	A	17: 29,144,477		probably null	Het
Ric1	A	G	19: 29,604,030	S1275G	probably benign	Het
Rnf213	C	A	11: 119,459,938		probably null	Het
Rtn4rl1	A	T	11: 75,265,726	E328V	probably benign	Het
Saraf	C	T	8: 34,165,274	T169I	probably damaging	Het
Sbk2	T	A	7: 4,957,120		probably null	Het
Setd1a	T	G	7: 127,795,724		probably benign	Het
Sit1	A	G	4: 43,483,157	Y73H	probably damaging	Het
Slc44a4	T	C	17: 34,923,423		probably benign	Het
Tas2r125	A	G	6: 132,910,227	T193A	probably benign	Het
Tbc1d9b	T	A	11: 50,161,701		probably null	Het
Tcf7l1	G	T	6: 72,627,420	H580Q	probably benign	Het
Tead1	T	G	7: 112,856,846	S115A	probably damaging	Het
Top2b	G	A	14: 16,413,947	G29D	probably damaging	Het
Trpv4	A	T	5: 114,635,552	C250S	probably damaging	Het
U2surp	A	C	9: 95,476,232	I655S	possibly damaging	Het
Ube2a	G	A	X: 36,874,707		probably benign	Het
Ubl7	A	G	9: 57,914,599	D77G	probably damaging	Het
Vmn1r91	T	C	7: 20,102,058	C301R	probably damaging	Het
Vmn2r90	A	T	17: 17,712,869	R230S	possibly damaging	Het
Wdfy3	T	A	5: 101,870,036	E2560V	probably damaging	Het
Zfp273	C	T	13: 67,825,776	A341V	probably benign	Het
Zfp512	C	T	5: 31,465,454	A33V	probably benign	Het

Other mutations in Nebl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02146:Nebl	APN	2	17348868	missense	probably damaging	0.99
IGL02732:Nebl	APN	2	17452484	splice site	probably benign
IGL03241:Nebl	APN	2	17393164	critical splice donor site	probably null
IGL03334:Nebl	APN	2	17413711	missense	probably damaging	0.98
BB008:Nebl	UTSW	2	17376622	critical splice donor site	probably null
BB018:Nebl	UTSW	2	17376622	critical splice donor site	probably null
R0068:Nebl	UTSW	2	17434971	nonsense	probably null
R0127:Nebl	UTSW	2	17392983	missense	probably benign	0.31
R0128:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17390926	start gained	probably benign
R0537:Nebl	UTSW	2	17404215	missense	possibly damaging	0.62
R0743:Nebl	UTSW	2	17411118	missense	probably benign
R0884:Nebl	UTSW	2	17411118	missense	probably benign
R1364:Nebl	UTSW	2	17393037	unclassified	probably benign
R1638:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R1711:Nebl	UTSW	2	17388754	missense	probably damaging	0.96
R1933:Nebl	UTSW	2	17375292	missense	probably damaging	0.97
R1990:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1991:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1992:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R2062:Nebl	UTSW	2	17397121	missense	probably benign	0.39
R2183:Nebl	UTSW	2	17404216	missense	probably damaging	0.99
R2325:Nebl	UTSW	2	17393016	missense	possibly damaging	0.79
R2877:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R2878:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R3079:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3080:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3878:Nebl	UTSW	2	17393252	missense	possibly damaging	0.83
R3947:Nebl	UTSW	2	17378106	critical splice donor site	probably null
R4983:Nebl	UTSW	2	17375271	missense	possibly damaging	0.80
R5006:Nebl	UTSW	2	17388771	splice site	probably null
R5256:Nebl	UTSW	2	17433975	missense	probably benign	0.37
R5491:Nebl	UTSW	2	17434972	nonsense	probably null
R5533:Nebl	UTSW	2	17393268	nonsense	probably null
R5597:Nebl	UTSW	2	17378167	missense	probably benign
R5658:Nebl	UTSW	2	17348852	missense	probably damaging	1.00
R5933:Nebl	UTSW	2	17404187	missense	probably benign
R6056:Nebl	UTSW	2	17450234	missense	probably benign	0.13
R6161:Nebl	UTSW	2	17730830	missense	probably benign	0.26
R6646:Nebl	UTSW	2	17376685	missense	probably damaging	1.00
R6784:Nebl	UTSW	2	17434914	nonsense	probably null
R6935:Nebl	UTSW	2	17348826	missense	probably damaging	1.00
R7196:Nebl	UTSW	2	17452518	missense	probably damaging	1.00
R7671:Nebl	UTSW	2	17390916	nonsense	probably null
R7728:Nebl	UTSW	2	17370514	missense
R7931:Nebl	UTSW	2	17376622	critical splice donor site	probably null
R8007:Nebl	UTSW	2	17370489	missense
R8048:Nebl	UTSW	2	17424522	missense	probably benign	0.12
R8118:Nebl	UTSW	2	17379820	missense	possibly damaging	0.48
R8317:Nebl	UTSW	2	17350757	missense	possibly damaging	0.71
R8349:Nebl	UTSW	2	17413782	missense	probably damaging	0.98
R8360:Nebl	UTSW	2	17460487	missense	probably benign	0.04
R8392:Nebl	UTSW	2	17452552	missense	probably benign	0.36
R8449:Nebl	UTSW	2	17413782	missense	probably damaging	0.98
X0012:Nebl	UTSW	2	17443794	missense	probably benign	0.16
X0025:Nebl	UTSW	2	17404267	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTCAGGAAAATATGCTCCAGTG -3'
(R):5'- CTTTATGGAAGGGGATGAATATCAG -3'

Sequencing Primer
(F):5'- CAGGAAAATATGCTCCAGTGTTTTC -3'
(R):5'- GAAAGGTAGCTTTTACTTGATC -3'

Posted On

2014-12-04