Mutagenetix > Incidental Mutations

Incidental Mutation 'R2679:Olfr32'

250698

Institutional Source

Beutler Lab

Gene Symbol

Olfr32

Ensembl Gene

ENSMUSG00000075066

Gene Name

olfactory receptor 32

Synonyms

MOR227-9_p, GA_x6K02T2Q125-51573576-51572650, MOR227-7P, MTPCR05

MMRRC Submission

040432-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R2679 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90136273-90142296 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90138545 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 198 (V198D)

Ref Sequence

ENSEMBL: ENSMUSP00000150370 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099755] [ENSMUST00000213293] [ENSMUST00000214973] [ENSMUST00000215153] [ENSMUST00000215659] [ENSMUST00000215765]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099755
AA Change: V198D

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097344
Gene: ENSMUSG00000075066
AA Change: V198D

Domain	Start	End	E-Value	Type
Pfam:7tm_4	28	302	1.7e-52	PFAM
Pfam:7tm_1	38	284	6.8e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213293
AA Change: V198D

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214973
AA Change: V198D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215153
AA Change: V198D

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215659
AA Change: V198D

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215765
AA Change: V198D

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asic2	A	G	11: 81,151,954	V171A	probably benign	Het
Atf7ip	A	T	6: 136,566,651	I641L	possibly damaging	Het
Atrn	G	A	2: 130,961,675		probably null	Het
Bpifb4	T	C	2: 153,948,624	I145T	probably damaging	Het
Bub3	A	G	7: 131,568,725		probably null	Het
Catsperb	T	A	12: 101,463,145	D192E	probably damaging	Het
Ccdc178	G	A	18: 21,811,556	H849Y	possibly damaging	Het
Cd101	G	T	3: 100,993,763	Q998K	probably benign	Het
Cep135	A	T	5: 76,624,660	M631L	probably benign	Het
Cit	T	C	5: 115,969,115	V1102A	probably benign	Het
Col4a4	G	A	1: 82,529,611	T249M	unknown	Het
Cpne6	A	T	14: 55,516,329	I415F	possibly damaging	Het
Cyp4b1	T	C	4: 115,628,697	I348V	probably benign	Het
Defb28	T	C	2: 152,518,282	S6P	possibly damaging	Het
Dhrs7b	A	G	11: 60,852,518		probably benign	Het
Dhx29	T	C	13: 112,947,376		probably null	Het
Egfem1	A	G	3: 29,670,676	T476A	probably benign	Het
Enpp5	A	G	17: 44,085,388	D397G	probably damaging	Het
Eogt	G	A	6: 97,120,800	T279I	probably benign	Het
Fnip2	G	A	3: 79,480,926	H833Y	probably benign	Het
Gabrr2	A	T	4: 33,071,435	T92S	probably damaging	Het
Gm10110	T	A	14: 89,897,416		noncoding transcript	Het
Gm4778	A	T	3: 94,265,910	Y75F	probably damaging	Het
Gria2	A	G	3: 80,740,953		probably benign	Het
Hmcn1	G	T	1: 150,652,575	T3274N	possibly damaging	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspa1b	T	C	17: 34,957,303	K569E	probably benign	Het
Ighv1-82	T	C	12: 115,952,752	Y46C	probably damaging	Het
Itga3	A	T	11: 95,068,310		probably benign	Het
Lrrc7	T	A	3: 158,175,108	R552*	probably null	Het
Med13	A	G	11: 86,298,577	S1169P	probably benign	Het
Muc4	T	A	16: 32,757,472	D2374E	unknown	Het
Myl9	T	A	2: 156,780,506	L70Q	probably damaging	Het
Nebl	C	T	2: 17,424,591	S243N	probably benign	Het
Nfat5	A	G	8: 107,344,914	Y314C	probably damaging	Het
Nr2f6	T	A	8: 71,374,736	D307V	probably damaging	Het
Nrp2	T	C	1: 62,785,078	S781P	probably benign	Het
Nub1	C	T	5: 24,692,925	T103I	possibly damaging	Het
Olfr572	T	A	7: 102,928,031	Y134*	probably null	Het
Pex5l	A	T	3: 33,082,052	M6K	probably benign	Het
Pgm3	A	C	9: 86,569,321	C93W	probably benign	Het
Pkhd1	A	G	1: 20,209,182	S2971P	probably benign	Het
Pkhd1l1	T	C	15: 44,545,386	L2423P	probably damaging	Het
Prkce	A	G	17: 86,176,226		probably benign	Het
Ptbp3	A	G	4: 59,494,615		probably benign	Het
Ptgis	T	A	2: 167,208,193	M339L	probably benign	Het
Pxdn	T	C	12: 29,975,569		probably benign	Het
Rab44	T	A	17: 29,144,477		probably null	Het
Ric1	A	G	19: 29,604,030	S1275G	probably benign	Het
Rnf213	C	A	11: 119,459,938		probably null	Het
Rtn4rl1	A	T	11: 75,265,726	E328V	probably benign	Het
Saraf	C	T	8: 34,165,274	T169I	probably damaging	Het
Sbk2	T	A	7: 4,957,120		probably null	Het
Setd1a	T	G	7: 127,795,724		probably benign	Het
Sit1	A	G	4: 43,483,157	Y73H	probably damaging	Het
Slc44a4	T	C	17: 34,923,423		probably benign	Het
Tas2r125	A	G	6: 132,910,227	T193A	probably benign	Het
Tbc1d9b	T	A	11: 50,161,701		probably null	Het
Tcf7l1	G	T	6: 72,627,420	H580Q	probably benign	Het
Tead1	T	G	7: 112,856,846	S115A	probably damaging	Het
Top2b	G	A	14: 16,413,947	G29D	probably damaging	Het
Trpv4	A	T	5: 114,635,552	C250S	probably damaging	Het
U2surp	A	C	9: 95,476,232	I655S	possibly damaging	Het
Ube2a	G	A	X: 36,874,707		probably benign	Het
Ubl7	A	G	9: 57,914,599	D77G	probably damaging	Het
Vmn1r91	T	C	7: 20,102,058	C301R	probably damaging	Het
Vmn2r90	A	T	17: 17,712,869	R230S	possibly damaging	Het
Wdfy3	T	A	5: 101,870,036	E2560V	probably damaging	Het
Zfp273	C	T	13: 67,825,776	A341V	probably benign	Het
Zfp512	C	T	5: 31,465,454	A33V	probably benign	Het

Other mutations in Olfr32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01328:Olfr32	APN	2	90139074	missense	probably benign	0.30
IGL01976:Olfr32	APN	2	90138924	missense	probably damaging	1.00
IGL02076:Olfr32	APN	2	90138815	missense	probably damaging	1.00
IGL03030:Olfr32	APN	2	90138662	missense	possibly damaging	0.93
IGL03235:Olfr32	APN	2	90139070	missense	possibly damaging	0.88
IGL03410:Olfr32	APN	2	90139145	start gained	probably benign
R1240:Olfr32	UTSW	2	90138813	missense	possibly damaging	0.48
R1511:Olfr32	UTSW	2	90138404	missense	probably benign	0.13
R1602:Olfr32	UTSW	2	90139055	missense	probably damaging	1.00
R1828:Olfr32	UTSW	2	90138587	missense	probably damaging	0.99
R2023:Olfr32	UTSW	2	90138856	nonsense	probably null
R2177:Olfr32	UTSW	2	90138464	missense	possibly damaging	0.70
R4490:Olfr32	UTSW	2	90138917	missense	probably damaging	0.97
R4585:Olfr32	UTSW	2	90138214	missense	probably benign	0.01
R4586:Olfr32	UTSW	2	90138214	missense	probably benign	0.01
R4649:Olfr32	UTSW	2	90139088	missense	probably damaging	0.99
R4688:Olfr32	UTSW	2	90138999	missense	possibly damaging	0.80
R4694:Olfr32	UTSW	2	90138249	nonsense	probably null
R5245:Olfr32	UTSW	2	90138262	missense	probably damaging	1.00
R5509:Olfr32	UTSW	2	90138892	missense	probably damaging	1.00
R5991:Olfr32	UTSW	2	90138234	nonsense	probably null
R6004:Olfr32	UTSW	2	90138999	missense	probably benign	0.32
R6128:Olfr32	UTSW	2	90138610	nonsense	probably null
R6519:Olfr32	UTSW	2	90138812	missense	possibly damaging	0.90
R7472:Olfr32	UTSW	2	90138324	missense	probably damaging	1.00
R7892:Olfr32	UTSW	2	90138492	missense	probably benign	0.00
R7975:Olfr32	UTSW	2	90138492	missense	probably benign	0.00
R8046:Olfr32	UTSW	2	90138815	missense	probably damaging	1.00
X0066:Olfr32	UTSW	2	90138390	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAGCTTGTCTTCAGTGTAGG -3'
(R):5'- TGAGTAGGCCCAAATGTCACC -3'

Sequencing Primer
(F):5'- AGGTGGAGGCAGGTCTC -3'
(R):5'- CCCAAATGTCACCGGCTG -3'

Posted On

2014-12-04