Incidental Mutation 'R0309:Ank1'
ID25071
Institutional Source Beutler Lab
Gene Symbol Ank1
Ensembl Gene ENSMUSG00000031543
Gene Nameankyrin 1, erythroid
SynonymsAnk-1, pale
MMRRC Submission 038519-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R0309 (G1)
Quality Score195
Status Validated
Chromosome8
Chromosomal Location22974844-23150497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23104809 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 204 (H204L)
Ref Sequence ENSEMBL: ENSMUSP00000116533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084038] [ENSMUST00000110688] [ENSMUST00000117270] [ENSMUST00000117296] [ENSMUST00000117662] [ENSMUST00000118733] [ENSMUST00000121802] [ENSMUST00000123418] [ENSMUST00000141784] [ENSMUST00000152511] [ENSMUST00000173248] [ENSMUST00000173573]
Predicted Effect probably damaging
Transcript: ENSMUST00000084038
AA Change: H611L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081051
Gene: ENSMUSG00000031543
AA Change: H611L

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110688
AA Change: H640L

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106316
Gene: ENSMUSG00000031543
AA Change: H640L

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 944 1048 1.9e-60 SMART
low complexity region 1071 1080 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
DEATH 1426 1520 3.21e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117270
AA Change: H640L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113495
Gene: ENSMUSG00000031543
AA Change: H640L

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117296
AA Change: H603L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113656
Gene: ENSMUSG00000031543
AA Change: H603L

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117662
AA Change: H603L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113531
Gene: ENSMUSG00000031543
AA Change: H603L

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118733
AA Change: H611L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112850
Gene: ENSMUSG00000031543
AA Change: H611L

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121802
AA Change: H640L

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113571
Gene: ENSMUSG00000031543
AA Change: H640L

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
ANK 44 73 2.5e3 SMART
ANK 77 106 3.26e0 SMART
ANK 110 139 3.15e-7 SMART
ANK 143 172 9.05e-8 SMART
ANK 176 204 4.67e-1 SMART
ANK 205 234 1.42e0 SMART
ANK 238 267 4.39e-6 SMART
ANK 271 300 1.33e-5 SMART
ANK 304 333 7.53e-5 SMART
ANK 337 366 2.35e-6 SMART
ANK 370 399 6.65e-6 SMART
ANK 403 432 5.2e-8 SMART
ANK 436 465 8.78e-6 SMART
ANK 469 498 7.53e-5 SMART
ANK 502 531 5.49e-7 SMART
ANK 535 564 2.58e-3 SMART
ANK 568 597 1.88e-5 SMART
ANK 601 630 1.02e-6 SMART
ANK 634 663 7.64e-6 SMART
ANK 667 698 3.23e-4 SMART
ANK 700 729 1.38e-3 SMART
ANK 733 762 1.58e-7 SMART
ANK 766 795 2.85e-5 SMART
ZU5 952 1056 1.9e-60 SMART
low complexity region 1079 1088 N/A INTRINSIC
low complexity region 1416 1426 N/A INTRINSIC
DEATH 1434 1528 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123418
SMART Domains Protein: ENSMUSP00000121785
Gene: ENSMUSG00000031543

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141784
AA Change: H603L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117966
Gene: ENSMUSG00000031543
AA Change: H603L

DomainStartEndE-ValueType
ANK 7 36 2.5e3 SMART
ANK 40 69 3.26e0 SMART
ANK 73 102 3.15e-7 SMART
ANK 106 135 9.05e-8 SMART
ANK 139 167 4.67e-1 SMART
ANK 168 197 1.42e0 SMART
ANK 201 230 4.39e-6 SMART
ANK 234 263 1.33e-5 SMART
ANK 267 296 7.53e-5 SMART
ANK 300 329 2.35e-6 SMART
ANK 333 362 6.65e-6 SMART
ANK 366 395 5.2e-8 SMART
ANK 399 428 8.78e-6 SMART
ANK 432 461 7.53e-5 SMART
ANK 465 494 5.49e-7 SMART
ANK 498 527 2.58e-3 SMART
ANK 531 560 1.88e-5 SMART
ANK 564 593 1.02e-6 SMART
ANK 597 626 7.64e-6 SMART
ANK 630 661 3.23e-4 SMART
ANK 663 692 1.38e-3 SMART
ANK 696 725 1.58e-7 SMART
ANK 729 758 2.85e-5 SMART
ZU5 907 1011 1.9e-60 SMART
low complexity region 1034 1043 N/A INTRINSIC
low complexity region 1371 1381 N/A INTRINSIC
DEATH 1389 1483 3.21e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152511
AA Change: H204L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116533
Gene: ENSMUSG00000031543
AA Change: H204L

DomainStartEndE-ValueType
ANK 1 29 4.82e-3 SMART
ANK 33 62 7.53e-5 SMART
ANK 66 95 5.49e-7 SMART
ANK 99 128 2.58e-3 SMART
ANK 132 161 1.88e-5 SMART
ANK 165 194 1.02e-6 SMART
ANK 198 227 7.64e-6 SMART
ANK 231 262 3.23e-4 SMART
ANK 264 293 1.38e-3 SMART
ANK 297 326 1.58e-7 SMART
ANK 330 359 2.85e-5 SMART
ZU5 508 612 1.9e-60 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
DEATH 990 1090 4.31e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173248
AA Change: H611L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133322
Gene: ENSMUSG00000031543
AA Change: H611L

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
low complexity region 1050 1059 N/A INTRINSIC
low complexity region 1387 1397 N/A INTRINSIC
DEATH 1405 1499 3.21e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173573
AA Change: H611L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133901
Gene: ENSMUSG00000031543
AA Change: H611L

DomainStartEndE-ValueType
ANK 15 44 2.5e3 SMART
ANK 48 77 3.26e0 SMART
ANK 81 110 3.15e-7 SMART
ANK 114 143 9.05e-8 SMART
ANK 147 175 4.67e-1 SMART
ANK 176 205 1.42e0 SMART
ANK 209 238 4.39e-6 SMART
ANK 242 271 1.33e-5 SMART
ANK 275 304 7.53e-5 SMART
ANK 308 337 2.35e-6 SMART
ANK 341 370 6.65e-6 SMART
ANK 374 403 5.2e-8 SMART
ANK 407 436 8.78e-6 SMART
ANK 440 469 7.53e-5 SMART
ANK 473 502 5.49e-7 SMART
ANK 506 535 2.58e-3 SMART
ANK 539 568 1.88e-5 SMART
ANK 572 601 1.02e-6 SMART
ANK 605 634 7.64e-6 SMART
ANK 638 669 3.23e-4 SMART
ANK 671 700 1.38e-3 SMART
ANK 704 733 1.58e-7 SMART
ANK 737 766 2.85e-5 SMART
ZU5 923 1027 1.9e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197671
Meta Mutation Damage Score 0.6397 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ankyrins are a family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 1, the prototype of this family, was first discovered in the erythrocytes, but since has also been found in brain and muscles. Mutations in erythrocytic ankyrin 1 have been associated in approximately half of all patients with hereditary spherocytosis. Complex patterns of alternative splicing in the regulatory domain, giving rise to different isoforms of ankyrin 1 have been described. Truncated muscle-specific isoforms of ankyrin 1 resulting from usage of an alternate promoter have also been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutant animals are anemic, infertile, and have reduced body size. Mutant animals also exhibit jaundice, bone marrow hyperplasia, splenomegaly, hepatomegaly, enlarged lymph nodes, increased white blood cell count, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,259 D133G possibly damaging Het
Abcb4 A C 5: 8,939,835 D796A probably damaging Het
Actg2 A T 6: 83,519,914 V147E probably damaging Het
Adamts13 A C 2: 26,986,989 T534P probably damaging Het
Ago1 T C 4: 126,443,166 T249A probably benign Het
Ahnak T A 19: 9,002,495 I381N probably damaging Het
Akap9 A G 5: 4,069,038 D3515G probably benign Het
Angptl3 T C 4: 99,034,469 V249A probably benign Het
Ank A G 15: 27,567,572 T294A possibly damaging Het
Apbb2 A G 5: 66,310,988 probably benign Het
Arhgap28 A T 17: 67,901,429 S15T probably benign Het
Aspm T C 1: 139,482,511 probably benign Het
Atp1a4 T C 1: 172,234,987 E651G probably damaging Het
B3gnt2 A T 11: 22,836,860 F109L probably damaging Het
Bpifb4 T C 2: 153,959,683 F575L probably damaging Het
Calr C A 8: 84,843,031 K322N probably benign Het
Ccdc188 T C 16: 18,219,305 S247P possibly damaging Het
Cdr1 T A X: 61,185,302 D86V unknown Het
Cep97 C T 16: 55,925,058 V48I probably damaging Het
Chaf1b T A 16: 93,884,511 C6S probably damaging Het
Chd3 C T 11: 69,357,018 D920N probably damaging Het
Clk1 T C 1: 58,413,033 probably benign Het
Cntnap3 T A 13: 64,757,436 probably benign Het
Col12a1 T A 9: 79,600,011 probably null Het
Col17a1 G T 19: 47,671,362 probably benign Het
Coq7 T A 7: 118,529,717 I32F possibly damaging Het
Cox6a2 A T 7: 128,205,935 F59I probably damaging Het
Cpq A G 15: 33,594,151 D436G probably damaging Het
Ctso G A 3: 81,944,861 probably null Het
Cxadr A T 16: 78,334,948 H274L probably benign Het
Cyp2c40 A T 19: 39,778,051 C367S possibly damaging Het
Cyp2c70 T G 19: 40,160,671 M344L possibly damaging Het
Defa35 G A 8: 21,065,855 V77I probably benign Het
Dhx57 A G 17: 80,274,881 Y432H probably damaging Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah7a C G 1: 53,405,690 D3952H probably damaging Het
Dnah9 C A 11: 66,026,972 probably benign Het
Dstyk C A 1: 132,456,864 probably benign Het
Efcab2 T A 1: 178,475,904 probably benign Het
Ehbp1l1 T C 19: 5,720,570 E287G possibly damaging Het
Epgn A G 5: 91,032,214 T87A probably benign Het
Erc2 A C 14: 28,141,225 E803A probably damaging Het
Fam26d A G 10: 34,044,047 W75R probably damaging Het
Fer A G 17: 64,139,016 *454W probably null Het
Glyr1 T C 16: 5,031,972 D179G probably damaging Het
Gm12830 T A 4: 114,844,976 probably benign Het
Gm14085 A T 2: 122,517,553 T253S probably benign Het
Gm9922 C A 14: 101,729,693 probably benign Het
Gsta3 C T 1: 21,264,894 P200S possibly damaging Het
Hmgxb3 G A 18: 61,155,128 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il16 T C 7: 83,722,554 K15E probably damaging Het
Kcnip2 T A 19: 45,794,075 probably benign Het
Kdm4c T C 4: 74,345,567 V696A probably benign Het
Kdr A G 5: 75,946,927 probably benign Het
Klhl33 T G 14: 50,891,411 H787P probably damaging Het
Klk14 A T 7: 43,694,345 T159S probably benign Het
Lancl2 A G 6: 57,703,132 N16D probably damaging Het
Lemd3 T C 10: 120,937,110 N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,271,015 probably null Het
Mpl T G 4: 118,446,038 probably benign Het
Myh7b T C 2: 155,630,672 probably benign Het
Mylk A C 16: 34,912,297 probably benign Het
Myof A T 19: 37,981,266 M316K probably benign Het
Nfib T A 4: 82,296,737 N543I probably damaging Het
Nfix A G 8: 84,721,774 S375P probably damaging Het
Nkrf T C X: 36,890,116 Q171R probably damaging Het
Nmnat2 T A 1: 153,077,001 probably benign Het
Npffr2 G A 5: 89,583,347 E379K probably benign Het
Npr2 T C 4: 43,640,904 probably benign Het
Nup98 A C 7: 102,152,428 D212E probably null Het
Nwd2 T C 5: 63,807,218 Y1382H probably damaging Het
Ocstamp T C 2: 165,395,992 R451G possibly damaging Het
Olfr593 T A 7: 103,212,721 I287K probably damaging Het
Olfr804 A G 10: 129,705,139 D87G probably benign Het
Pabpc1 C T 15: 36,597,493 A551T possibly damaging Het
Papd7 A T 13: 69,499,932 V781E possibly damaging Het
Pard3 A T 8: 127,376,897 probably benign Het
Pcdhb12 G T 18: 37,436,121 V107L probably benign Het
Pik3cd A T 4: 149,663,220 V22D probably damaging Het
Pkd1l2 A G 8: 116,997,576 V2396A probably damaging Het
Pnpla7 T C 2: 24,987,195 I167T probably damaging Het
Pphln1 A T 15: 93,441,707 H114L possibly damaging Het
Ppm1h A G 10: 122,920,782 N444S probably damaging Het
Prdm9 G A 17: 15,557,384 T146I probably damaging Het
Prrc2a A G 17: 35,150,915 probably benign Het
Prrx1 T C 1: 163,312,559 D26G possibly damaging Het
Ptpn5 T C 7: 47,079,294 E495G probably damaging Het
Rab23 A C 1: 33,734,861 probably null Het
Ralgps1 C T 2: 33,157,923 M348I probably benign Het
Ranbp2 A G 10: 58,479,868 T2137A probably benign Het
Rapgef4 G T 2: 72,226,030 G654V probably benign Het
Rc3h2 A T 2: 37,379,008 probably benign Het
Reg2 G A 6: 78,406,186 A39T possibly damaging Het
Sema4d C A 13: 51,725,311 V7F probably benign Het
Sgip1 T C 4: 102,915,157 probably benign Het
Sgpl1 C T 10: 61,113,437 probably null Het
Shisa9 G A 16: 11,997,123 V212M probably damaging Het
Shq1 G A 6: 100,573,627 P450L probably benign Het
Sin3a A G 9: 57,110,912 T872A probably benign Het
Sipa1l3 C T 7: 29,348,350 R1371Q probably benign Het
Skint8 T C 4: 111,938,867 V246A probably benign Het
Slc22a20 A T 19: 5,972,957 V386D probably damaging Het
Slc2a7 G A 4: 150,158,071 probably benign Het
Slc35a2 T A X: 7,889,662 Y48N probably damaging Het
Slc4a2 G T 5: 24,434,346 S413I probably damaging Het
Sntg2 T C 12: 30,226,773 T427A probably benign Het
Soat1 T C 1: 156,442,453 Y132C probably damaging Het
Stn1 G T 19: 47,501,673 H342N probably benign Het
Tarbp1 T A 8: 126,438,928 probably benign Het
Tas2r113 A C 6: 132,893,378 K123T probably damaging Het
Tbck C T 3: 132,734,407 Q504* probably null Het
Tenm3 C T 8: 48,341,034 C380Y probably damaging Het
Triobp A G 15: 78,976,540 D1389G probably damaging Het
Trpm4 A T 7: 45,308,706 F780I probably damaging Het
Tubb4a G T 17: 57,081,182 Y281* probably null Het
Txndc15 T C 13: 55,724,582 F261S probably damaging Het
Ube3b T C 5: 114,419,469 probably benign Het
Unc5c G C 3: 141,733,933 V196L probably benign Het
Upf3a G A 8: 13,795,500 probably null Het
Vmn2r20 T C 6: 123,386,104 K574E probably benign Het
Vps50 A G 6: 3,536,853 M275V possibly damaging Het
Xrcc5 A G 1: 72,307,576 probably benign Het
Zbtb18 T C 1: 177,448,616 L505S probably damaging Het
Zbtb41 T C 1: 139,438,984 I567T probably damaging Het
Zfp598 T C 17: 24,678,584 probably benign Het
Other mutations in Ank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Ank1 APN 8 23141644 missense probably damaging 1.00
IGL01099:Ank1 APN 8 23108249 missense probably damaging 0.97
IGL01586:Ank1 APN 8 23120912 missense probably benign
IGL01866:Ank1 APN 8 23093855 missense possibly damaging 0.88
IGL01977:Ank1 APN 8 23115433 missense probably benign 0.01
IGL02109:Ank1 APN 8 23096184 missense probably damaging 1.00
IGL02182:Ank1 APN 8 23113852 missense possibly damaging 0.89
IGL02261:Ank1 APN 8 23087999 missense probably damaging 1.00
IGL02283:Ank1 APN 8 23119434 critical splice donor site probably null
IGL02335:Ank1 APN 8 23135638 missense possibly damaging 0.86
IGL02933:Ank1 APN 8 23122865 missense possibly damaging 0.52
IGL03056:Ank1 APN 8 23141179 missense probably damaging 1.00
IGL03089:Ank1 APN 8 23104832 missense probably benign 0.00
IGL03257:Ank1 APN 8 23122898 missense probably damaging 1.00
IGL03389:Ank1 APN 8 23088060 critical splice donor site probably null
Hema6 UTSW 8 23097638 intron probably benign
R0030:Ank1 UTSW 8 23093893 missense probably damaging 1.00
R0077:Ank1 UTSW 8 23140167 missense probably damaging 1.00
R0081:Ank1 UTSW 8 23116242 missense possibly damaging 0.95
R0147:Ank1 UTSW 8 23123977 missense probably damaging 1.00
R0148:Ank1 UTSW 8 23123977 missense probably damaging 1.00
R0200:Ank1 UTSW 8 23096812 missense probably damaging 1.00
R0270:Ank1 UTSW 8 23088925 splice site probably benign
R0490:Ank1 UTSW 8 23107874 splice site probably benign
R0675:Ank1 UTSW 8 23110384 splice site probably benign
R0738:Ank1 UTSW 8 23114114 missense probably damaging 0.98
R1051:Ank1 UTSW 8 23093940 missense probably damaging 1.00
R1239:Ank1 UTSW 8 23096155 missense probably damaging 1.00
R1265:Ank1 UTSW 8 23117037 missense possibly damaging 0.64
R1367:Ank1 UTSW 8 23111803 splice site probably benign
R1413:Ank1 UTSW 8 23119377 missense probably damaging 1.00
R1539:Ank1 UTSW 8 23093919 missense probably damaging 1.00
R1682:Ank1 UTSW 8 23109327 missense probably damaging 1.00
R1732:Ank1 UTSW 8 23111463 splice site probably benign
R1911:Ank1 UTSW 8 23099650 missense probably damaging 1.00
R2087:Ank1 UTSW 8 23093811 missense probably damaging 1.00
R2184:Ank1 UTSW 8 23109254 missense probably damaging 0.98
R2302:Ank1 UTSW 8 23119399 missense probably damaging 1.00
R2356:Ank1 UTSW 8 23085672 missense probably damaging 1.00
R2495:Ank1 UTSW 8 23132264 missense probably damaging 1.00
R3000:Ank1 UTSW 8 23119431 missense probably damaging 1.00
R3113:Ank1 UTSW 8 23084797 missense probably damaging 1.00
R3710:Ank1 UTSW 8 23087079 missense probably damaging 1.00
R3768:Ank1 UTSW 8 23116186 missense possibly damaging 0.92
R3771:Ank1 UTSW 8 23123897 missense probably benign 0.03
R4002:Ank1 UTSW 8 23139463 missense probably damaging 0.98
R4478:Ank1 UTSW 8 23120578 missense probably benign 0.30
R4755:Ank1 UTSW 8 23104974 missense probably damaging 1.00
R4756:Ank1 UTSW 8 23122877 missense probably benign
R4979:Ank1 UTSW 8 23132196 missense probably damaging 0.98
R4989:Ank1 UTSW 8 23141118 intron probably benign
R5011:Ank1 UTSW 8 23082284 missense probably damaging 1.00
R5013:Ank1 UTSW 8 23082284 missense probably damaging 1.00
R5031:Ank1 UTSW 8 23099680 missense probably damaging 1.00
R5051:Ank1 UTSW 8 23119381 missense probably damaging 1.00
R5059:Ank1 UTSW 8 23096188 missense probably damaging 0.99
R5086:Ank1 UTSW 8 23088618 missense probably damaging 1.00
R5108:Ank1 UTSW 8 23132555 missense probably benign 0.11
R5235:Ank1 UTSW 8 23082196 missense probably damaging 1.00
R5300:Ank1 UTSW 8 23132501 missense probably benign 0.00
R5408:Ank1 UTSW 8 23082193 missense probably damaging 1.00
R5537:Ank1 UTSW 8 23114876 missense probably damaging 1.00
R5728:Ank1 UTSW 8 23122767 critical splice acceptor site probably null
R5746:Ank1 UTSW 8 23116596 missense probably damaging 1.00
R5837:Ank1 UTSW 8 23104790 missense probably damaging 0.99
R5907:Ank1 UTSW 8 23140204 missense probably damaging 1.00
R5997:Ank1 UTSW 8 23099662 missense probably damaging 1.00
R6005:Ank1 UTSW 8 23132202 missense probably damaging 1.00
R6046:Ank1 UTSW 8 23116098 missense probably damaging 1.00
R6103:Ank1 UTSW 8 23113983 missense probably damaging 1.00
R6268:Ank1 UTSW 8 23109671 missense probably damaging 1.00
R6430:Ank1 UTSW 8 23132109 missense probably damaging 1.00
R6457:Ank1 UTSW 8 23087967 missense probably damaging 1.00
R6626:Ank1 UTSW 8 22975191 missense probably damaging 0.98
R6935:Ank1 UTSW 8 23108231 missense probably damaging 1.00
R7091:Ank1 UTSW 8 23058663 missense probably benign
R7162:Ank1 UTSW 8 23132354 missense possibly damaging 0.94
R7475:Ank1 UTSW 8 23132630 missense probably benign
R7546:Ank1 UTSW 8 23064995 missense probably damaging 1.00
R7678:Ank1 UTSW 8 23117058 missense probably damaging 0.98
R7768:Ank1 UTSW 8 23097997 missense probably benign 0.01
R7779:Ank1 UTSW 8 23096747 critical splice acceptor site probably null
R7864:Ank1 UTSW 8 23087960 missense probably damaging 1.00
R7947:Ank1 UTSW 8 23087960 missense probably damaging 1.00
RF024:Ank1 UTSW 8 23119344 missense probably benign 0.37
X0066:Ank1 UTSW 8 23141584 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTTTACACCTGCCAGCTCCGAGAG -3'
(R):5'- TGTTTAGCAGAGAAGCCGACACC -3'

Sequencing Primer
(F):5'- CAGCTCCGAGAGCCTGC -3'
(R):5'- cagagaagccgacacctacatC -3'
Posted On2013-04-16