Mutagenetix > Incidental Mutations

Incidental Mutation 'R2679:Fnip2'

250714

Institutional Source

Beutler Lab

Gene Symbol

Fnip2

Ensembl Gene

ENSMUSG00000061175

Gene Name

folliculin interacting protein 2

Synonyms

D630023B12Rik

MMRRC Submission

040432-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2679 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79455974-79567796 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 79480926 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 833 (H833Y)

Ref Sequence

ENSEMBL: ENSMUSP00000115275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076136] [ENSMUST00000133154]

Predicted Effect

probably benign
Transcript: ENSMUST00000076136
AA Change: H803Y

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175
AA Change: H803Y

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	42	168	4.3e-39	PFAM
low complexity region	240	261	N/A	INTRINSIC
Pfam:FNIP_M	289	528	5.9e-92	PFAM
low complexity region	557	571	N/A	INTRINSIC
low complexity region	748	755	N/A	INTRINSIC
Pfam:FNIP_C	920	1104	4.1e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133154
AA Change: H833Y

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175
AA Change: H833Y

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	42	164	5.2e-34	PFAM
low complexity region	270	291	N/A	INTRINSIC
Pfam:FNIP_M	323	557	3.9e-93	PFAM
low complexity region	587	601	N/A	INTRINSIC
low complexity region	778	785	N/A	INTRINSIC
Pfam:FNIP_C	951	1134	2.3e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154645

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in regulating the O6-methylguanine-induced apoptosis signaling pathway. This protein may also play a role cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 1, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele have normal lifespans. Mice with combined loss of this gene and a single null allele of Fnip1 develop kidney cancer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asic2	A	G	11: 81,151,954	V171A	probably benign	Het
Atf7ip	A	T	6: 136,566,651	I641L	possibly damaging	Het
Atrn	G	A	2: 130,961,675		probably null	Het
Bpifb4	T	C	2: 153,948,624	I145T	probably damaging	Het
Bub3	A	G	7: 131,568,725		probably null	Het
Catsperb	T	A	12: 101,463,145	D192E	probably damaging	Het
Ccdc178	G	A	18: 21,811,556	H849Y	possibly damaging	Het
Cd101	G	T	3: 100,993,763	Q998K	probably benign	Het
Cep135	A	T	5: 76,624,660	M631L	probably benign	Het
Cit	T	C	5: 115,969,115	V1102A	probably benign	Het
Col4a4	G	A	1: 82,529,611	T249M	unknown	Het
Cpne6	A	T	14: 55,516,329	I415F	possibly damaging	Het
Cyp4b1	T	C	4: 115,628,697	I348V	probably benign	Het
Defb28	T	C	2: 152,518,282	S6P	possibly damaging	Het
Dhrs7b	A	G	11: 60,852,518		probably benign	Het
Dhx29	T	C	13: 112,947,376		probably null	Het
Egfem1	A	G	3: 29,670,676	T476A	probably benign	Het
Enpp5	A	G	17: 44,085,388	D397G	probably damaging	Het
Eogt	G	A	6: 97,120,800	T279I	probably benign	Het
Gabrr2	A	T	4: 33,071,435	T92S	probably damaging	Het
Gm10110	T	A	14: 89,897,416		noncoding transcript	Het
Gm4778	A	T	3: 94,265,910	Y75F	probably damaging	Het
Gria2	A	G	3: 80,740,953		probably benign	Het
Hmcn1	G	T	1: 150,652,575	T3274N	possibly damaging	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspa1b	T	C	17: 34,957,303	K569E	probably benign	Het
Ighv1-82	T	C	12: 115,952,752	Y46C	probably damaging	Het
Itga3	A	T	11: 95,068,310		probably benign	Het
Lrrc7	T	A	3: 158,175,108	R552*	probably null	Het
Med13	A	G	11: 86,298,577	S1169P	probably benign	Het
Muc4	T	A	16: 32,757,472	D2374E	unknown	Het
Myl9	T	A	2: 156,780,506	L70Q	probably damaging	Het
Nebl	C	T	2: 17,424,591	S243N	probably benign	Het
Nfat5	A	G	8: 107,344,914	Y314C	probably damaging	Het
Nr2f6	T	A	8: 71,374,736	D307V	probably damaging	Het
Nrp2	T	C	1: 62,785,078	S781P	probably benign	Het
Nub1	C	T	5: 24,692,925	T103I	possibly damaging	Het
Olfr32	A	T	2: 90,138,545	V198D	possibly damaging	Het
Olfr572	T	A	7: 102,928,031	Y134*	probably null	Het
Pex5l	A	T	3: 33,082,052	M6K	probably benign	Het
Pgm3	A	C	9: 86,569,321	C93W	probably benign	Het
Pkhd1	A	G	1: 20,209,182	S2971P	probably benign	Het
Pkhd1l1	T	C	15: 44,545,386	L2423P	probably damaging	Het
Prkce	A	G	17: 86,176,226		probably benign	Het
Ptbp3	A	G	4: 59,494,615		probably benign	Het
Ptgis	T	A	2: 167,208,193	M339L	probably benign	Het
Pxdn	T	C	12: 29,975,569		probably benign	Het
Rab44	T	A	17: 29,144,477		probably null	Het
Ric1	A	G	19: 29,604,030	S1275G	probably benign	Het
Rnf213	C	A	11: 119,459,938		probably null	Het
Rtn4rl1	A	T	11: 75,265,726	E328V	probably benign	Het
Saraf	C	T	8: 34,165,274	T169I	probably damaging	Het
Sbk2	T	A	7: 4,957,120		probably null	Het
Setd1a	T	G	7: 127,795,724		probably benign	Het
Sit1	A	G	4: 43,483,157	Y73H	probably damaging	Het
Slc44a4	T	C	17: 34,923,423		probably benign	Het
Tas2r125	A	G	6: 132,910,227	T193A	probably benign	Het
Tbc1d9b	T	A	11: 50,161,701		probably null	Het
Tcf7l1	G	T	6: 72,627,420	H580Q	probably benign	Het
Tead1	T	G	7: 112,856,846	S115A	probably damaging	Het
Top2b	G	A	14: 16,413,947	G29D	probably damaging	Het
Trpv4	A	T	5: 114,635,552	C250S	probably damaging	Het
U2surp	A	C	9: 95,476,232	I655S	possibly damaging	Het
Ube2a	G	A	X: 36,874,707		probably benign	Het
Ubl7	A	G	9: 57,914,599	D77G	probably damaging	Het
Vmn1r91	T	C	7: 20,102,058	C301R	probably damaging	Het
Vmn2r90	A	T	17: 17,712,869	R230S	possibly damaging	Het
Wdfy3	T	A	5: 101,870,036	E2560V	probably damaging	Het
Zfp273	C	T	13: 67,825,776	A341V	probably benign	Het
Zfp512	C	T	5: 31,465,454	A33V	probably benign	Het

Other mutations in Fnip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Fnip2	APN	3	79481521	missense	probably benign
IGL00339:Fnip2	APN	3	79515155	missense	probably benign	0.12
IGL00340:Fnip2	APN	3	79518061	splice site	probably benign
IGL00434:Fnip2	APN	3	79512489	splice site	probably benign
IGL01134:Fnip2	APN	3	79512503	nonsense	probably null
IGL02732:Fnip2	APN	3	79465697	missense	probably damaging	1.00
IGL03327:Fnip2	APN	3	79518081	missense	probably damaging	0.98
IGL03402:Fnip2	APN	3	79481276	missense	possibly damaging	0.92
R0314:Fnip2	UTSW	3	79481189	missense	probably damaging	1.00
R0318:Fnip2	UTSW	3	79512378	missense	probably damaging	1.00
R0699:Fnip2	UTSW	3	79481139	missense	probably benign	0.00
R1188:Fnip2	UTSW	3	79462162	missense	probably damaging	1.00
R1290:Fnip2	UTSW	3	79465693	missense	probably damaging	1.00
R1406:Fnip2	UTSW	3	79508091	missense	possibly damaging	0.85
R1406:Fnip2	UTSW	3	79508091	missense	possibly damaging	0.85
R1535:Fnip2	UTSW	3	79481765	missense	probably damaging	1.00
R1618:Fnip2	UTSW	3	79508168	missense	possibly damaging	0.70
R1661:Fnip2	UTSW	3	79515149	missense	probably benign
R1665:Fnip2	UTSW	3	79515149	missense	probably benign
R1965:Fnip2	UTSW	3	79493472	missense	probably benign	0.31
R1966:Fnip2	UTSW	3	79493472	missense	probably benign	0.31
R1976:Fnip2	UTSW	3	79480931	missense	probably benign	0.02
R2004:Fnip2	UTSW	3	79512325	splice site	probably benign
R2054:Fnip2	UTSW	3	79572465	unclassified	probably benign
R2145:Fnip2	UTSW	3	79500432	missense	probably damaging	0.99
R2400:Fnip2	UTSW	3	79479634	missense	probably benign	0.03
R3157:Fnip2	UTSW	3	79567594	missense	probably damaging	1.00
R3851:Fnip2	UTSW	3	79462157	missense	probably damaging	1.00
R3910:Fnip2	UTSW	3	79479505	missense	possibly damaging	0.83
R3911:Fnip2	UTSW	3	79479505	missense	possibly damaging	0.83
R3912:Fnip2	UTSW	3	79479505	missense	possibly damaging	0.83
R4035:Fnip2	UTSW	3	79479501	missense	probably benign	0.00
R4166:Fnip2	UTSW	3	79462135	missense	probably damaging	1.00
R4537:Fnip2	UTSW	3	79465714	missense	probably damaging	0.98
R4732:Fnip2	UTSW	3	79481652	missense	probably damaging	1.00
R4733:Fnip2	UTSW	3	79481652	missense	probably damaging	1.00
R4774:Fnip2	UTSW	3	79465721	nonsense	probably null
R4923:Fnip2	UTSW	3	79489394	critical splice acceptor site	probably null
R5043:Fnip2	UTSW	3	79492867	nonsense	probably null
R5160:Fnip2	UTSW	3	79488991	missense	probably damaging	1.00
R5162:Fnip2	UTSW	3	79481777	missense	probably damaging	1.00
R5196:Fnip2	UTSW	3	79572538	unclassified	probably benign
R5283:Fnip2	UTSW	3	79465708	missense	probably damaging	1.00
R5364:Fnip2	UTSW	3	79481168	missense	probably benign	0.00
R5402:Fnip2	UTSW	3	79480943	missense	possibly damaging	0.89
R6340:Fnip2	UTSW	3	79507845	missense	probably damaging	1.00
R6459:Fnip2	UTSW	3	79481634	missense	possibly damaging	0.93
R6592:Fnip2	UTSW	3	79481708	missense	probably benign	0.26
R6616:Fnip2	UTSW	3	79480882	missense	probably benign	0.00
R6933:Fnip2	UTSW	3	79518111	missense	probably benign	0.28
R6962:Fnip2	UTSW	3	79489303	missense	probably damaging	1.00
R6971:Fnip2	UTSW	3	79481121	nonsense	probably null
R7050:Fnip2	UTSW	3	79506270	missense	probably damaging	0.99
R7097:Fnip2	UTSW	3	79481006	missense	probably benign
R7315:Fnip2	UTSW	3	79506205	critical splice donor site	probably null
R7714:Fnip2	UTSW	3	79518114	missense	probably damaging	1.00
R7782:Fnip2	UTSW	3	79508123	missense	probably benign	0.00
R8381:Fnip2	UTSW	3	79465693	missense	probably damaging	1.00
R8479:Fnip2	UTSW	3	79512555	missense	probably damaging	1.00
R8485:Fnip2	UTSW	3	79481537	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TGTAGTTGCCCTTACCACTGG -3'
(R):5'- GGACATTTCCATGGGGCTAGTG -3'

Sequencing Primer
(F):5'- CATAGGGGACATCTGCAGCAATC -3'
(R):5'- AGTGCCTCTGCCAGCTCTAG -3'

Posted On

2014-12-04