Incidental Mutation 'R2679:Cd101'
ID250720
Institutional Source Beutler Lab
Gene Symbol Cd101
Ensembl Gene ENSMUSG00000086564
Gene NameCD101 antigen
SynonymsIgsf2, LOC381460
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2679 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location100993529-101029556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100993763 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 998 (Q998K)
Ref Sequence ENSEMBL: ENSMUSP00000126027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147399] [ENSMUST00000167086]
Predicted Effect probably benign
Transcript: ENSMUST00000147399
AA Change: Q1002K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116643
Gene: ENSMUSG00000086564
AA Change: Q1002K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 28 143 4.96e-8 SMART
IG 153 266 4.74e-5 SMART
IG_like 274 379 2.19e-1 SMART
IG 289 395 3.25e-3 SMART
IG 417 533 4.85e-11 SMART
IG 545 659 1.52e-3 SMART
IG 680 805 3.16e-1 SMART
IG_like 827 927 2.95e-1 SMART
IG 856 955 1.04e-1 SMART
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167086
AA Change: Q998K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126027
Gene: ENSMUSG00000086564
AA Change: Q998K

DomainStartEndE-ValueType
IG 24 139 4.96e-8 SMART
IG 149 262 4.74e-5 SMART
IG_like 270 375 2.19e-1 SMART
IG 285 391 3.25e-3 SMART
IG 413 529 4.85e-11 SMART
IG 541 655 1.52e-3 SMART
IG 676 801 3.16e-1 SMART
IG_like 823 923 2.95e-1 SMART
IG 852 951 1.04e-1 SMART
transmembrane domain 967 989 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Gr-1+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Cd101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Cd101 APN 3 101003702 missense probably damaging 1.00
IGL01443:Cd101 APN 3 101003571 missense probably benign
IGL02000:Cd101 APN 3 101012082 missense probably benign 0.11
IGL02178:Cd101 APN 3 100993766 missense probably damaging 1.00
IGL02224:Cd101 APN 3 101017002 missense probably benign
IGL02450:Cd101 APN 3 100993738 missense probably damaging 0.99
IGL02502:Cd101 APN 3 101011825 missense probably damaging 0.99
IGL02536:Cd101 APN 3 101003597 missense probably damaging 1.00
IGL02749:Cd101 APN 3 101020399 missense probably damaging 1.00
IGL02818:Cd101 APN 3 101011929 missense probably damaging 1.00
IGL02829:Cd101 APN 3 101018565 splice site probably benign
IGL02902:Cd101 APN 3 101018994 splice site probably benign
tax_day UTSW 3 101003705 missense possibly damaging 0.86
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0411:Cd101 UTSW 3 101018527 splice site probably null
R0486:Cd101 UTSW 3 101008092 missense possibly damaging 0.94
R0556:Cd101 UTSW 3 101020654 missense probably damaging 1.00
R0726:Cd101 UTSW 3 101020622 missense possibly damaging 0.95
R0966:Cd101 UTSW 3 101008222 missense probably benign 0.13
R1344:Cd101 UTSW 3 101018775 nonsense probably null
R1418:Cd101 UTSW 3 101018775 nonsense probably null
R1547:Cd101 UTSW 3 101018951 missense possibly damaging 0.94
R1551:Cd101 UTSW 3 101012013 missense probably damaging 0.99
R1845:Cd101 UTSW 3 101029448 splice site probably null
R1919:Cd101 UTSW 3 101018917 missense probably damaging 1.00
R1976:Cd101 UTSW 3 101008061 missense probably damaging 0.96
R2260:Cd101 UTSW 3 101016945 missense possibly damaging 0.82
R2873:Cd101 UTSW 3 101003848 missense probably benign 0.00
R3606:Cd101 UTSW 3 101020597 missense probably damaging 1.00
R4201:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4202:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4205:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4349:Cd101 UTSW 3 101013314 missense possibly damaging 0.93
R4574:Cd101 UTSW 3 101013153 missense probably benign 0.02
R4601:Cd101 UTSW 3 100993888 missense possibly damaging 0.84
R4820:Cd101 UTSW 3 101022155 missense probably benign 0.01
R4910:Cd101 UTSW 3 100993889 missense probably benign 0.13
R5014:Cd101 UTSW 3 101003823 missense probably damaging 0.99
R5081:Cd101 UTSW 3 101003705 missense possibly damaging 0.86
R5396:Cd101 UTSW 3 101018810 missense probably damaging 1.00
R5425:Cd101 UTSW 3 101018686 missense probably damaging 1.00
R6193:Cd101 UTSW 3 101020462 missense probably damaging 1.00
R6210:Cd101 UTSW 3 101018643 missense probably damaging 1.00
R6732:Cd101 UTSW 3 101008199 missense probably benign 0.01
R6830:Cd101 UTSW 3 100993696 missense probably benign 0.12
R6897:Cd101 UTSW 3 101013060 missense probably damaging 1.00
R6940:Cd101 UTSW 3 101003702 missense probably damaging 1.00
R7335:Cd101 UTSW 3 101018729 missense probably benign 0.01
R7565:Cd101 UTSW 3 101018792 missense probably benign 0.00
R7880:Cd101 UTSW 3 101007866 missense probably benign 0.00
R8121:Cd101 UTSW 3 101020582 missense probably damaging 1.00
R8233:Cd101 UTSW 3 100993673 missense unknown
X0018:Cd101 UTSW 3 101018632 missense possibly damaging 0.95
X0023:Cd101 UTSW 3 101018855 missense probably benign
X0058:Cd101 UTSW 3 101020421 missense probably damaging 1.00
Z1177:Cd101 UTSW 3 101011916 missense probably benign 0.03
Z1177:Cd101 UTSW 3 101017140 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACAATCTATGTCCATGGCACATC -3'
(R):5'- CGATCGTTGGGACACTGATTG -3'

Sequencing Primer
(F):5'- TGGTAACTTGGCCAAGGTCTAAAAC -3'
(R):5'- GGGACACTGATTGATTGTCTTC -3'
Posted On2014-12-04