Mutagenetix > Incidental Mutations

Incidental Mutation 'R2679:Gabrr2'

250726

Institutional Source

Beutler Lab

Gene Symbol

Gabrr2

Ensembl Gene

ENSMUSG00000023267

Gene Name

gamma-aminobutyric acid (GABA) C receptor, subunit rho 2

Synonyms

MMRRC Submission

040432-MU

Accession Numbers

Genbank: NM_008076; MGI: 95626; Ensembl: ENSMUST00000108162, ENSMUST00000147889, ENSMUST00000131920, ENSMUST00000024035

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2679 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33062999-33095865 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 33071435 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 92 (T92S)

Ref Sequence

ENSEMBL: ENSMUSP00000024035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024035] [ENSMUST00000108162]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024035
AA Change: T92S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024035
Gene: ENSMUSG00000023267
AA Change: T92S

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	81	286	3.4e-53	PFAM
Pfam:Neur_chan_memb	293	454	1.9e-32	PFAM
transmembrane domain	472	489	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108162
AA Change: T67S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000103797
Gene: ENSMUSG00000023267
AA Change: T67S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Neur_chan_LBD	57	261	9.7e-57	PFAM
Pfam:Neur_chan_memb	268	414	4.2e-36	PFAM
transmembrane domain	447	464	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability. [provided by RefSeq, Apr 2016]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asic2	A	G	11: 81,151,954	V171A	probably benign	Het
Atf7ip	A	T	6: 136,566,651	I641L	possibly damaging	Het
Atrn	G	A	2: 130,961,675		probably null	Het
Bpifb4	T	C	2: 153,948,624	I145T	probably damaging	Het
Bub3	A	G	7: 131,568,725		probably null	Het
Catsperb	T	A	12: 101,463,145	D192E	probably damaging	Het
Ccdc178	G	A	18: 21,811,556	H849Y	possibly damaging	Het
Cd101	G	T	3: 100,993,763	Q998K	probably benign	Het
Cep135	A	T	5: 76,624,660	M631L	probably benign	Het
Cit	T	C	5: 115,969,115	V1102A	probably benign	Het
Col4a4	G	A	1: 82,529,611	T249M	unknown	Het
Cpne6	A	T	14: 55,516,329	I415F	possibly damaging	Het
Cyp4b1	T	C	4: 115,628,697	I348V	probably benign	Het
Defb28	T	C	2: 152,518,282	S6P	possibly damaging	Het
Dhrs7b	A	G	11: 60,852,518		probably benign	Het
Dhx29	T	C	13: 112,947,376		probably null	Het
Egfem1	A	G	3: 29,670,676	T476A	probably benign	Het
Enpp5	A	G	17: 44,085,388	D397G	probably damaging	Het
Eogt	G	A	6: 97,120,800	T279I	probably benign	Het
Fnip2	G	A	3: 79,480,926	H833Y	probably benign	Het
Gm10110	T	A	14: 89,897,416		noncoding transcript	Het
Gm4778	A	T	3: 94,265,910	Y75F	probably damaging	Het
Gria2	A	G	3: 80,740,953		probably benign	Het
Hmcn1	G	T	1: 150,652,575	T3274N	possibly damaging	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspa1b	T	C	17: 34,957,303	K569E	probably benign	Het
Ighv1-82	T	C	12: 115,952,752	Y46C	probably damaging	Het
Itga3	A	T	11: 95,068,310		probably benign	Het
Lrrc7	T	A	3: 158,175,108	R552*	probably null	Het
Med13	A	G	11: 86,298,577	S1169P	probably benign	Het
Muc4	T	A	16: 32,757,472	D2374E	unknown	Het
Myl9	T	A	2: 156,780,506	L70Q	probably damaging	Het
Nebl	C	T	2: 17,424,591	S243N	probably benign	Het
Nfat5	A	G	8: 107,344,914	Y314C	probably damaging	Het
Nr2f6	T	A	8: 71,374,736	D307V	probably damaging	Het
Nrp2	T	C	1: 62,785,078	S781P	probably benign	Het
Nub1	C	T	5: 24,692,925	T103I	possibly damaging	Het
Olfr32	A	T	2: 90,138,545	V198D	possibly damaging	Het
Olfr572	T	A	7: 102,928,031	Y134*	probably null	Het
Pex5l	A	T	3: 33,082,052	M6K	probably benign	Het
Pgm3	A	C	9: 86,569,321	C93W	probably benign	Het
Pkhd1	A	G	1: 20,209,182	S2971P	probably benign	Het
Pkhd1l1	T	C	15: 44,545,386	L2423P	probably damaging	Het
Prkce	A	G	17: 86,176,226		probably benign	Het
Ptbp3	A	G	4: 59,494,615		probably benign	Het
Ptgis	T	A	2: 167,208,193	M339L	probably benign	Het
Pxdn	T	C	12: 29,975,569		probably benign	Het
Rab44	T	A	17: 29,144,477		probably null	Het
Ric1	A	G	19: 29,604,030	S1275G	probably benign	Het
Rnf213	C	A	11: 119,459,938		probably null	Het
Rtn4rl1	A	T	11: 75,265,726	E328V	probably benign	Het
Saraf	C	T	8: 34,165,274	T169I	probably damaging	Het
Sbk2	T	A	7: 4,957,120		probably null	Het
Setd1a	T	G	7: 127,795,724		probably benign	Het
Sit1	A	G	4: 43,483,157	Y73H	probably damaging	Het
Slc44a4	T	C	17: 34,923,423		probably benign	Het
Tas2r125	A	G	6: 132,910,227	T193A	probably benign	Het
Tbc1d9b	T	A	11: 50,161,701		probably null	Het
Tcf7l1	G	T	6: 72,627,420	H580Q	probably benign	Het
Tead1	T	G	7: 112,856,846	S115A	probably damaging	Het
Top2b	G	A	14: 16,413,947	G29D	probably damaging	Het
Trpv4	A	T	5: 114,635,552	C250S	probably damaging	Het
U2surp	A	C	9: 95,476,232	I655S	possibly damaging	Het
Ube2a	G	A	X: 36,874,707		probably benign	Het
Ubl7	A	G	9: 57,914,599	D77G	probably damaging	Het
Vmn1r91	T	C	7: 20,102,058	C301R	probably damaging	Het
Vmn2r90	A	T	17: 17,712,869	R230S	possibly damaging	Het
Wdfy3	T	A	5: 101,870,036	E2560V	probably damaging	Het
Zfp273	C	T	13: 67,825,776	A341V	probably benign	Het
Zfp512	C	T	5: 31,465,454	A33V	probably benign	Het

Other mutations in Gabrr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Gabrr2	APN	4	33085626	missense	probably damaging	1.00
IGL02070:Gabrr2	APN	4	33095340	nonsense	probably null
IGL03283:Gabrr2	APN	4	33082364	splice site	probably benign
D3080:Gabrr2	UTSW	4	33084466	missense	probably damaging	1.00
R1250:Gabrr2	UTSW	4	33063273	missense	probably benign	0.20
R1381:Gabrr2	UTSW	4	33081420	missense	probably damaging	1.00
R1630:Gabrr2	UTSW	4	33085647	missense	probably damaging	1.00
R1782:Gabrr2	UTSW	4	33085593	missense	probably damaging	1.00
R1830:Gabrr2	UTSW	4	33077481	missense	probably damaging	1.00
R2000:Gabrr2	UTSW	4	33084400	missense	probably damaging	1.00
R2125:Gabrr2	UTSW	4	33095548	missense	probably damaging	1.00
R3695:Gabrr2	UTSW	4	33071430	missense	probably damaging	1.00
R3891:Gabrr2	UTSW	4	33081348	missense	probably damaging	1.00
R3892:Gabrr2	UTSW	4	33081348	missense	probably damaging	1.00
R4902:Gabrr2	UTSW	4	33095512	missense	probably damaging	1.00
R5328:Gabrr2	UTSW	4	33082565	missense	probably damaging	1.00
R5330:Gabrr2	UTSW	4	33082583	missense	possibly damaging	0.87
R5331:Gabrr2	UTSW	4	33082583	missense	possibly damaging	0.87
R5399:Gabrr2	UTSW	4	33071458	critical splice donor site	probably null
R7299:Gabrr2	UTSW	4	33095284	missense	probably benign	0.02
R7301:Gabrr2	UTSW	4	33095284	missense	probably benign	0.02
R7605:Gabrr2	UTSW	4	33082560	missense	probably damaging	1.00
R7697:Gabrr2	UTSW	4	33071358	missense	probably benign
R7860:Gabrr2	UTSW	4	33081470	nonsense	probably null
R7957:Gabrr2	UTSW	4	33081410	missense	probably damaging	0.99
R8161:Gabrr2	UTSW	4	33082566	missense	probably damaging	1.00
R8185:Gabrr2	UTSW	4	33082330	missense	probably damaging	1.00
R8463:Gabrr2	UTSW	4	33084375	missense	probably damaging	1.00
X0017:Gabrr2	UTSW	4	33082328	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTGTAGAGACCCTTTAGTC -3'
(R):5'- TGTCAACAGCCTCTCCACTG -3'

Sequencing Primer
(F):5'- GCCTCCTTGTGTGCATCAGAATAAAG -3'
(R):5'- ACTGCCTGCCTGTGACCAC -3'

Posted On

2014-12-04