Incidental Mutation 'R2679:Nub1'
ID250733
Institutional Source Beutler Lab
Gene Symbol Nub1
Ensembl Gene ENSMUSG00000028954
Gene Namenegative regulator of ubiquitin-like proteins 1
SynonymsNY-REN-18, 4931404D21Rik, 6330412F12Rik, BS4
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R2679 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24685532-24710378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24692925 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 103 (T103I)
Ref Sequence ENSEMBL: ENSMUSP00000143657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068825] [ENSMUST00000197407]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068825
AA Change: T79I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070265
Gene: ENSMUSG00000028954
AA Change: T79I

DomainStartEndE-ValueType
coiled coil region 37 70 N/A INTRINSIC
PDB:1WJU|A 71 162 2e-45 PDB
low complexity region 167 186 N/A INTRINSIC
UBA 375 412 7.29e-8 SMART
UBA 431 468 1.61e-9 SMART
UBA 490 527 1.95e-8 SMART
low complexity region 539 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181925
Predicted Effect possibly damaging
Transcript: ENSMUST00000197407
AA Change: T103I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143657
Gene: ENSMUSG00000028954
AA Change: T103I

DomainStartEndE-ValueType
coiled coil region 61 94 N/A INTRINSIC
PDB:1WJU|A 95 186 2e-45 PDB
low complexity region 191 210 N/A INTRINSIC
UBA 399 436 3.5e-10 SMART
UBA 455 492 8.1e-12 SMART
UBA 514 551 9.5e-11 SMART
low complexity region 563 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200337
Meta Mutation Damage Score 0.0820 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a negative regulator of NEDD8, a ubiquitin-like protein that conjugates with cullin family members in order to regulate vital biological events. The protein encoded by this gene regulates the NEDD8 conjugation system post-transcriptionally by recruiting NEDD8 and its conjugates to the proteasome for degradation. This protein interacts with the product of the AIPL1 gene, which is associated with Leber congenital amaurosis, an inherited retinopathy, and mutations in that gene can abolish interaction with this protein, which may contribute to the pathogenesis. This protein is also known to accumulate in Lewy bodies in Parkinson's disease and dementia with Lewy bodies, and in glial cytoplasmic inclusions in multiple system atrophy, with this abnormal accumulation being specific to alpha-synucleinopathy lesions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Nub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Nub1 APN 5 24689394 start codon destroyed probably null 0.99
IGL02626:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02629:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02633:Nub1 APN 5 24692933 missense probably benign 0.00
IGL02798:Nub1 APN 5 24692814 missense probably damaging 1.00
IGL03384:Nub1 APN 5 24697427 splice site probably benign
IGL03384:Nub1 APN 5 24697426 splice site probably null
R2484:Nub1 UTSW 5 24708702 missense possibly damaging 0.91
R3825:Nub1 UTSW 5 24707853 missense probably benign 0.21
R4180:Nub1 UTSW 5 24692877 missense probably damaging 0.99
R4593:Nub1 UTSW 5 24709121 missense probably damaging 1.00
R4921:Nub1 UTSW 5 24701469 missense probably benign 0.38
R5175:Nub1 UTSW 5 24702448 missense probably benign 0.28
R5282:Nub1 UTSW 5 24695535 missense probably benign 0.04
R5346:Nub1 UTSW 5 24697416 missense probably damaging 0.96
R5533:Nub1 UTSW 5 24702381 missense possibly damaging 0.93
R5567:Nub1 UTSW 5 24708816 missense possibly damaging 0.54
R5802:Nub1 UTSW 5 24702441 missense possibly damaging 0.95
R6966:Nub1 UTSW 5 24689472 missense probably damaging 1.00
R6967:Nub1 UTSW 5 24708711 missense probably benign
R7540:Nub1 UTSW 5 24701529 missense probably damaging 1.00
R7787:Nub1 UTSW 5 24708803 missense probably benign 0.03
Z1177:Nub1 UTSW 5 24702458 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACACATGCAGTTTTCTTGTGTG -3'
(R):5'- AACAGTTTGCTGAGCATGTG -3'

Sequencing Primer
(F):5'- GTGTGTGCACTGGATCTCCC -3'
(R):5'- GTCTTTAATCCTAGCAGAGGCAGC -3'
Posted On2014-12-04