Incidental Mutation 'R2679:Trpv4'
ID250742
Institutional Source Beutler Lab
Gene Symbol Trpv4
Ensembl Gene ENSMUSG00000014158
Gene Nametransient receptor potential cation channel, subfamily V, member 4
SynonymsVROAC, 0610033B08Rik, Trp12, VR-OAC, VRL-2, OTRPC4
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R2679 (G1)
Quality Score188
Status Validated
Chromosome5
Chromosomal Location114622152-114658421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114635552 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 250 (C250S)
Ref Sequence ENSEMBL: ENSMUSP00000107844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071968] [ENSMUST00000112217] [ENSMUST00000112219] [ENSMUST00000112222] [ENSMUST00000112225]
Predicted Effect probably damaging
Transcript: ENSMUST00000071968
AA Change: C250S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071859
Gene: ENSMUSG00000014158
AA Change: C250S

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 468 730 9.9e-13 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112217
AA Change: C250S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107836
Gene: ENSMUSG00000014158
AA Change: C250S

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 1e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 2e-12 BLAST
ANK 369 397 1.02e3 SMART
transmembrane domain 409 431 N/A INTRINSIC
Pfam:Ion_trans 455 658 3.3e-8 PFAM
Blast:PHB 693 744 4e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112219
SMART Domains Protein: ENSMUSP00000107838
Gene: ENSMUSG00000014158

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 350 1.02e3 SMART
transmembrane domain 362 384 N/A INTRINSIC
Pfam:Ion_trans 408 611 3e-8 PFAM
Blast:PHB 646 697 4e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112222
SMART Domains Protein: ENSMUSP00000107840
Gene: ENSMUSG00000014158

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 351 3.49e0 SMART
low complexity region 368 378 N/A INTRINSIC
Blast:ANK 395 420 1e-6 BLAST
Pfam:Ion_trans 468 671 3.4e-8 PFAM
Blast:PHB 706 757 5e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112225
AA Change: C250S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107844
Gene: ENSMUSG00000014158
AA Change: C250S

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 515 718 3.4e-8 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212469
Meta Mutation Damage Score 0.2171 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the OSM9-like transient receptor potential channel (OTRPC) subfamily in the transient receptor potential (TRP) superfamily of ion channels. The encoded protein is a Ca2+-permeable, nonselective cation channel that is thought to be involved in the regulation of systemic osmotic pressure. Mutations in this gene are the cause of spondylometaphyseal and metatropic dysplasia and hereditary motor and sensory neuropathy type IIC. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a null allele show abnormal touch/ nociception and late-onset hearing loss. Homozygotes for a different null allele show impaired bladder voiding, abnormalities in touch/ nociception, osmotic regulation and vasodilation, ocular hypertension but no hearing or vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Trpv4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Trpv4 APN 5 114628625 missense probably damaging 1.00
IGL01804:Trpv4 APN 5 114644786 missense possibly damaging 0.77
IGL01955:Trpv4 APN 5 114622682 nonsense probably null
IGL02115:Trpv4 APN 5 114625029 missense probably damaging 1.00
IGL02375:Trpv4 APN 5 114636357 missense probably benign 0.10
IGL02870:Trpv4 APN 5 114625056 missense probably damaging 1.00
PIT4472001:Trpv4 UTSW 5 114626923 missense probably damaging 0.99
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0217:Trpv4 UTSW 5 114634661 missense possibly damaging 0.68
R0346:Trpv4 UTSW 5 114630529 splice site probably benign
R0358:Trpv4 UTSW 5 114630432 missense probably damaging 1.00
R1745:Trpv4 UTSW 5 114633154 missense probably damaging 1.00
R1880:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R1881:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R2018:Trpv4 UTSW 5 114634605 missense probably damaging 1.00
R2093:Trpv4 UTSW 5 114635504 missense probably damaging 1.00
R2172:Trpv4 UTSW 5 114644710 missense probably damaging 1.00
R3699:Trpv4 UTSW 5 114634800 missense probably damaging 1.00
R4731:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4732:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4733:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4822:Trpv4 UTSW 5 114630022 missense possibly damaging 0.66
R4985:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R4987:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R5026:Trpv4 UTSW 5 114622654 makesense probably null
R5105:Trpv4 UTSW 5 114626920 missense probably damaging 1.00
R5236:Trpv4 UTSW 5 114622795 missense possibly damaging 0.81
R5330:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5331:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5396:Trpv4 UTSW 5 114623614 missense possibly damaging 0.77
R5423:Trpv4 UTSW 5 114636445 missense probably benign 0.25
R5667:Trpv4 UTSW 5 114634556 missense probably damaging 1.00
R5896:Trpv4 UTSW 5 114622647 utr 3 prime probably benign
R6239:Trpv4 UTSW 5 114644826 missense probably benign
R6762:Trpv4 UTSW 5 114625110 missense probably benign 0.07
R6952:Trpv4 UTSW 5 114633202 missense probably damaging 1.00
R7191:Trpv4 UTSW 5 114633140 missense probably benign
R7343:Trpv4 UTSW 5 114636459 missense probably benign 0.42
R7951:Trpv4 UTSW 5 114622810 missense probably benign 0.33
R8551:Trpv4 UTSW 5 114630839 missense possibly damaging 0.96
Z1177:Trpv4 UTSW 5 114634612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAACTTTCTCCAGAGCTC -3'
(R):5'- TGTCATGCACCCCAAATCTC -3'

Sequencing Primer
(F):5'- CAGGTCTAAGTATGTGGGAGTCACC -3'
(R):5'- TCTCACATCAACCCTGCGC -3'
Posted On2014-12-04